C-930 lot 211005

RSP 12603

Grower: NSI

General Information

Sample Name
NSI Hemp
Accession Date
February 10, 2022
Reported Plant Sex
not reported

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Common
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type II

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.66%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0390
male female RSP12603

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.221C>G p.Thr74Ser missense variant moderate contig1772 2082447

IGV: Start, Jump

C/G
NGS:
0.136
C90:
0.057
CBDAS c.503A>G p.Asn168Ser missense variant moderate contig1772 2082729

IGV: Start, Jump

A/G
NGS:
0.024
C90:
0.062
CBDAS c.587A>G p.Asn196Ser missense variant moderate contig1772 2082813

IGV: Start, Jump

A/G
NGS:
0.011
C90:
0.435
CBDAS c.1628G>A p.Arg543His missense variant moderate contig1772 2083854

IGV: Start, Jump

G/A
NGS:
0.033
C90:
0.000

Variants (Select Genes of Interest)

GPPs1

UniProt

c.744C>G p.Asp248Glu missense variant moderate contig676 168993

IGV: Start, Jump

C/G
NGS:
0.022
C90:
0.000
GPPs1

UniProt

c.896A>G p.Asn299Ser missense variant moderate contig676 169772

IGV: Start, Jump

A/G
NGS:
0.046
C90:
0.000
EMF1-2

UniProt

c.1187T>C p.Leu396Ser missense variant moderate contig885 2073

IGV: Start, Jump

T/C
NGS:
0.026
C90:
0.000
EMF1-2

UniProt

c.2256A>T p.Lys752Asn missense variant moderate contig885 3142

IGV: Start, Jump

A/T
NGS:
0.026
C90:
0.000
PHL-2 c.932T>C p.Leu311Pro missense variant moderate contig2621 340210

IGV: Start, Jump

T/C
NGS:
0.039
C90:
0.268
PHL-2 c.1837G>A p.Glu613Lys missense variant moderate contig2621 341115

IGV: Start, Jump

G/A
NGS:
0.009
C90:
0.000
PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

T/A
NGS:
0.064
C90:
0.732
PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.746
PHL-2 c.2624C>T p.Ser875Phe missense variant moderate contig2621 342667

IGV: Start, Jump

C/T
NGS:
0.042
C90:
0.268
PHL-2 c.2756A>C p.Glu919Ala missense variant moderate contig2621 342799

IGV: Start, Jump

A/C
NGS:
0.064
C90:
0.675
PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

G/A
NGS:
0.107
C90:
0.890
PHL-2 c.2830A>G p.Asn944Asp missense variant moderate contig2621 342873

IGV: Start, Jump

A/G
NGS:
0.018
C90:
0.000
PHL-2 c.2933G>T p.Arg978Leu missense variant moderate contig2621 342976

IGV: Start, Jump

G/T
NGS:
0.048
C90:
0.297
PHL-2 c.2936T>G p.Val979Gly missense variant moderate contig2621 342979

IGV: Start, Jump

T/G
NGS:
0.048
C90:
0.000
PHL-2 c.3209A>G p.Gln1070Arg missense variant moderate contig2621 343252

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.885
PHL-2 c.3467A>G p.Gln1156Arg missense variant moderate contig2621 343510

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.713
PKSG-4a

UniProt

c.839_840delTT p.Ile280fs frameshift variant high contig700 1938249

IGV: Start, Jump

ATT/A
NGS:
0.000
C90:
0.000
PKSG-4b

UniProt

c.535_545delATTGGAGTGGG p.Ile179fs frameshift variant high contig700 2721127

IGV: Start, Jump

CCCCACTCCAAT/C
NGS:
0.105
C90:
0.000
PKSG-4b

UniProt

c.544G>T p.Gly182Trp missense variant moderate contig700 2721129

IGV: Start, Jump

C/A
NGS:
0.055
C90:
0.000
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.419A>G p.Asp140Gly missense variant moderate contig700 2721254

IGV: Start, Jump

T/C
NGS:
0.430
C90:
0.440
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.353_354insCC p.Gly119fs frameshift variant high contig700 2721319

IGV: Start, Jump

T/TGG
NGS:
0.175
C90:
0.000
PKSG-4b

UniProt

c.338G>A p.Gly113Glu missense variant moderate contig700 2721335

IGV: Start, Jump

C/T
NGS:
0.046
C90:
0.000
PKSG-4b

UniProt

c.324A>C p.Glu108Asp missense variant moderate contig700 2721349

IGV: Start, Jump

T/G
NGS:
0.094
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
PKSG-4b

UniProt

c.245A>G p.Asn82Ser missense variant moderate contig700 2724190

IGV: Start, Jump

T/C
NGS:
0.000
C90:
0.000
PKSG-4b

UniProt

c.235_239dupAGATT p.Phe80fs frameshift variant high contig700 2724195

IGV: Start, Jump

G/GAATCT
NGS:
0.018
C90:
0.000
PKSG-4b

UniProt

c.238T>C p.Phe80Leu missense variant moderate contig700 2724197

IGV: Start, Jump

A/G
NGS:
0.013
C90:
0.000
PKSG-4b

UniProt

c.229G>A p.Gly77Ser missense variant moderate contig700 2724206

IGV: Start, Jump

C/T
NGS:
0.042
C90:
0.000
PKSG-4b

UniProt

c.216G>C p.Leu72Phe missense variant moderate contig700 2724219

IGV: Start, Jump

C/G
NGS:
0.044
C90:
0.000
PKSG-4b

UniProt

c.206T>C p.Leu69Ser missense variant moderate contig700 2724229

IGV: Start, Jump

A/G
NGS:
0.044
C90:
0.000
AAE1-1

UniProt

c.1419_1420insA p.Glu474fs frameshift variant high contig606 3242851

IGV: Start, Jump

C/CT
NGS:
0.000
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
DXR-2

UniProt

c.431C>G p.Ala144Gly missense variant moderate contig380 287760

IGV: Start, Jump

G/C
NGS:
0.182
C90:
0.550
ELF4

UniProt

c.144T>A p.Asp48Glu missense variant moderate contig869 622426

IGV: Start, Jump

A/T
NGS:
0.031
C90:
0.000
ELF3

UniProt

c.364_366delAAG p.Lys122del conservative inframe deletion moderate contig97 242066

IGV: Start, Jump

AAAG/A
NGS:
0.004
C90:
0.000
ELF3

UniProt

c.757C>T p.Pro253Ser missense variant moderate contig97 242463

IGV: Start, Jump

C/T
NGS:
0.020
C90:
0.048
ELF3

UniProt

c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump

A/G
NGS:
0.112
C90:
0.000
ELF3

UniProt

c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump

G/C
NGS:
0.114
C90:
0.938
ELF3

UniProt

c.1230-2_1230-1delAG splice acceptor variant & intron variant high contig97 243676

IGV: Start, Jump

TAG/T
NGS:
0.088
C90:
0.450
ELF3

UniProt

c.1366T>G p.Leu456Val missense variant moderate contig97 244197

IGV: Start, Jump

T/G
NGS:
0.015
C90:
0.000
ELF3

UniProt

c.1435G>C p.Ala479Pro missense variant moderate contig97 244266

IGV: Start, Jump

G/C
NGS:
0.004
C90:
0.000
ELF3

UniProt

c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump

G/A
NGS:
0.123
C90:
0.000
ELF3

UniProt

c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.545
ELF3

UniProt

c.1803_1805delTCA p.His601del disruptive inframe deletion moderate contig97 244625

IGV: Start, Jump

ACAT/A
NGS:
0.092
C90:
0.000
ELF3

UniProt

c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump

C/G
NGS:
0.123
C90:
0.632
ELF3

UniProt

c.2140C>T p.Pro714Ser missense variant moderate contig97 244971

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.038
ELF3

UniProt

c.2141C>G p.Pro714Arg missense variant moderate contig97 244972

IGV: Start, Jump

C/G
NGS:
0.088
C90:
0.335
ELF3

UniProt

c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump

G/T
NGS:
0.125
C90:
0.531
ELF3

UniProt

c.2203C>A p.His735Asn missense variant moderate contig97 245034

IGV: Start, Jump

C/A
NGS:
0.002
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.198A>C p.Lys66Asn missense variant moderate contig121 2828854

IGV: Start, Jump

A/C
NGS:
0.044
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT1

UniProt

c.612delT p.Phe204fs frameshift variant high contig121 2840216

IGV: Start, Jump

GT/G
NGS:
0.000
C90:
0.000
aPT1

UniProt

c.727G>T p.Glu243* stop gained high contig121 2841362

IGV: Start, Jump

G/T
NGS:
0.127
C90:
0.100
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000
AAE1-2

UniProt

c.205T>A p.Ser69Thr missense variant moderate contig81 209167

IGV: Start, Jump

T/A
NGS:
0.013
C90:
0.000
AAE1-2

UniProt

c.409C>T p.Arg137Cys missense variant moderate contig81 209371

IGV: Start, Jump

C/T
NGS:
0.009
C90:
0.000
AAE1-2

UniProt

c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump

A/G
NGS:
0.116
C90:
0.000
AAE1-2

UniProt

c.1102C>A p.His368Asn missense variant moderate contig81 210064

IGV: Start, Jump

C/A
NGS:
0.033
C90:
0.000
AAE1-2

UniProt

c.1541T>C p.Val514Ala missense variant moderate contig81 210503

IGV: Start, Jump

T/C
NGS:
0.050
C90:
0.000
PHL-1

UniProt

c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump

T/C
NGS:
0.123
C90:
0.000
PHL-1

UniProt

c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump

T/C
NGS:
0.116
C90:
0.890
PHL-1

UniProt

c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump

T/C
NGS:
0.107
C90:
0.904
PHL-1

UniProt

c.176G>A p.Gly59Glu missense variant moderate contig1439 1492817

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.000
PHL-1

UniProt

c.175G>A p.Gly59Arg missense variant moderate contig1439 1492818

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.144
Edestin

UniProt

c.16T>C p.Ser6Pro missense variant moderate contig850 3065274

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.000
HDS-1

UniProt

c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump

T/C
NGS:
0.099
C90:
0.861
HDS-1

UniProt

c.136G>A p.Val46Ile missense variant moderate contig1891 889256

IGV: Start, Jump

C/T
NGS:
0.088
C90:
0.593
HDS-1

UniProt

c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump

G/C
NGS:
0.125
C90:
0.943
HDS-1

UniProt

c.35G>A p.Cys12Tyr missense variant moderate contig1891 889357

IGV: Start, Jump

C/T
NGS:
0.094
C90:
0.646
HDS-1

UniProt

c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump

A/AC
NGS:
0.217
C90:
0.000
PIE1-2

UniProt

c.6653A>G p.Asn2218Ser missense variant moderate contig1460 1184434

IGV: Start, Jump

T/C
NGS:
0.059
C90:
0.928
PIE1-2

UniProt

c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump

A/T
NGS:
0.086
C90:
0.990
PIE1-2

UniProt

c.1520delA p.Asn507fs frameshift variant high contig1460 1191790

IGV: Start, Jump

AT/A
NGS:
0.000
C90:
0.000
EMF2

UniProt

c.1205C>T p.Ala402Val missense variant & splice region variant moderate contig954 3055694

IGV: Start, Jump

C/T
NGS:
0.015
C90:
0.053
EMF2

UniProt

c.1228A>G p.Ser410Gly missense variant moderate contig954 3055717

IGV: Start, Jump

A/G
NGS:
0.015
C90:
0.000
EMF2

UniProt

c.1315G>C p.Ala439Pro missense variant moderate contig954 3055804

IGV: Start, Jump

G/C
NGS:
0.015
C90:
0.053
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
EMF1-1

UniProt

c.242A>G p.Lys81Arg missense variant moderate contig883 269731

IGV: Start, Jump

A/G
NGS:
0.022
C90:
0.053
EMF1-1

UniProt

c.627_629dupTGT p.Val210dup disruptive inframe insertion moderate contig883 270231

IGV: Start, Jump

A/ATGT
NGS:
0.007
C90:
0.000
FLD

UniProt

c.2869C>T p.His957Tyr missense variant moderate contig1450 2044163

IGV: Start, Jump

G/A
NGS:
0.011
C90:
0.000
FLD

UniProt

c.2831A>G p.Glu944Gly missense variant moderate contig1450 2044201

IGV: Start, Jump

T/C
NGS:
0.011
C90:
0.000
FLD

UniProt

c.2811_2813dupGGG p.Gly938dup disruptive inframe insertion & splice region variant moderate contig1450 2044218

IGV: Start, Jump

T/TCCC
NGS:
0.000
C90:
0.000
FLD

UniProt

c.2686G>A p.Ala896Thr missense variant moderate contig1450 2044848

IGV: Start, Jump

C/T
NGS:
0.035
C90:
0.225
FLD

UniProt

c.125G>A p.Ser42Asn missense variant moderate contig1450 2047909

IGV: Start, Jump

C/T
NGS:
0.037
C90:
0.388
AAE1-3

UniProt

c.667G>A p.Val223Ile missense variant moderate contig976 1083187

IGV: Start, Jump

C/T
NGS:
0.048
C90:
0.000
AAE1-3

UniProt

c.655C>T p.Pro219Ser missense variant moderate contig976 1083199

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.635G>A p.Gly212Asp missense variant moderate contig976 1083219

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump

C/G
NGS:
0.116
C90:
0.000
AAE1-3

UniProt

c.483_484insACT p.Thr161dup conservative inframe insertion moderate contig976 1083541

IGV: Start, Jump

C/CAGT
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.480_481insGTAAAAATCCTCCTCTTAATTTCTTACAGCTCTTTAATCTTTTACTATTTTATTGGTTGCTGAAAACCTCGGTCA p.Asn160_Thr161insValLysIleLeuLeuLeuIleSerTyrSerSerLeuIlePheTyrTyrPheIleGlyCysTerLysProArgSer stop gained & conservative inframe insertion high contig976 1083544

IGV: Start, Jump

T/TTGACCGAGGTTTTCAGCAACCAATAAAATAGTAAAAGATTAAAGAGCTGTAAGAAATTAAGAGGAGGATTTTTAC
NGS:
0.000
C90:
0.000
AAE1-3

UniProt

c.403G>T p.Asp135Tyr missense variant moderate contig976 1083622

IGV: Start, Jump

C/A
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.382T>C p.Tyr128His missense variant moderate contig976 1083643

IGV: Start, Jump

A/G
NGS:
0.072
C90:
0.000
AAE1-3

UniProt

c.367C>T p.Arg123Trp missense variant moderate contig976 1083658

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.293A>G p.Asp98Gly missense variant moderate contig976 1083732

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.208G>C p.Ala70Pro missense variant moderate contig976 1083867

IGV: Start, Jump

C/G
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.199A>G p.Asn67Asp missense variant moderate contig976 1083876

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
AAE1-3

UniProt

c.188A>G p.Asn63Ser missense variant moderate contig976 1083887

IGV: Start, Jump

T/C
NGS:
0.077
C90:
0.000
AAE1-3

UniProt

c.181G>A p.Val61Ile missense variant moderate contig976 1083894

IGV: Start, Jump

C/T
NGS:
0.055
C90:
0.000
AAE1-3

UniProt

c.167A>G p.Glu56Gly missense variant moderate contig976 1083908

IGV: Start, Jump

T/C
NGS:
0.070
C90:
0.000
AAE1-3

UniProt

c.154G>A p.Val52Ile missense variant moderate contig976 1083921

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.101A>G p.Tyr34Cys missense variant moderate contig976 1083974

IGV: Start, Jump

T/C
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.79A>G p.Thr27Ala missense variant moderate contig976 1083996

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
GGR

UniProt

c.32C>A p.Thr11Lys missense variant moderate contig2282 549024

IGV: Start, Jump

C/A
NGS:
0.009
C90:
0.000
GGR

UniProt

c.456T>A p.His152Gln missense variant moderate contig2282 549448

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
GGR

UniProt

c.460G>A p.Asp154Asn missense variant moderate contig2282 549452

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
PKSB-3

UniProt

c.509T>C p.Val170Ala missense variant & splice region variant moderate contig93 3336743

IGV: Start, Jump

T/C
NGS:
0.011
C90:
0.000
PKSB-3

UniProt

c.1490C>T p.Ala497Val missense variant moderate contig93 3339597

IGV: Start, Jump

C/T
NGS:
0.011
C90:
0.000
PKSB-3

UniProt

c.1652A>G p.Glu551Gly missense variant moderate contig93 3339759

IGV: Start, Jump

A/G
NGS:
0.088
C90:
0.000
PKSB-3

UniProt

c.1848G>A p.Met616Ile missense variant moderate contig93 3339955

IGV: Start, Jump

G/A
NGS:
0.009
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.042 0.083 0.125 0.167
clone distance sibling distance more distant
  1. 0.055 B52 (SRR14708255)
  2. 0.093 Alpine Rocket (SRR14708266)
  3. 0.097 VIR 483 (SRR14708238)
  4. 0.102 PCL1 (SRR14708246)
  5. 0.110 VIR 493 - Glukhovskaja 10 Zheltostebel'naja (SRR14708230)
  6. 0.111 Electra (RSP11366)
  7. 0.114 R1in136 (SRR14708237)
  8. 0.115 Kompolti (SRR14708277)
  9. 0.117 VIR 469 (SRR14708242)
  10. 0.118 Northern Light (SRR14708265)
  11. 0.119 PP9 (SRR14708260)
  12. 0.127 IUL3 (SRR14708252)
  13. 0.132 R2in135 (SRR14708236)
  14. 0.139 Cream Sugar (RSP12487)
  15. 0.140 VIR 469 (SRR14708243)
  16. 0.147 Pie Scream (RSP12482)
  17. 0.148 Cherry Lime Runtz (RSP12486)
  18. 0.148 VIR 483 (SRR14708239)
  19. 0.149 Serious Happiness (RSP10763)
  20. 0.149 Uniko B (SRR14708278)

Nearest genetic relatives (Base Tree)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.167 Tygra (RSP10667)
  2. 0.191 Blueberry Cheesecake (RSP10684)
  3. 0.195 Tisza (RSP10659)
  4. 0.198 Lovrin (RSP10658)
  5. 0.200 Tisza (RSP11044)
  6. 0.205 Futura 75 (RSP10664)
  7. 0.207 USO 31 (RSP10981)
  8. 0.214 Carmagnola (RSP10979)
  9. 0.221 Ivory (RSP10668)
  10. 0.222 Santhica27 (RSP11047)
  11. 0.223 Liberty Haze (RSP11000)
  12. 0.231 Fedora 17 (RSP10661)
  13. 0.233 Monoica (RSP10241)
  14. 0.236 Recon (RSP10755)
  15. 0.237 Kimbo Slice (RSP10997)
  16. 0.238 Durban Poison (RSP11014)
  17. 0.240 Carmagnola (RSP11037)
  18. 0.244 UP Sunrise (RSP10989)
  19. 0.248 Kyrgyz Gold (RSP11054)
  20. 0.248 KYRG-11 (RSP11051)

Most genetically distant strains (All Samples)

0 0.108 0.217 0.325 0.433
clone distance sibling distance more distant
  1. 0.402 Chem 91 (RSP11185)
  2. 0.400 80E (RSP11213)
  3. 0.389 Kush Hemp E1 (RSP11128)
  4. 0.383 RKM-2018-012 (RSP11103)
  5. 0.381 Right Mark (RSP11628)
  6. 0.381 Cbot-2019-005 (RSP11133)
  7. 0.379 Danny Noonan (RSP11070)
  8. 0.375 Cherry Blossom (RSP11323)
  9. 0.372 80E (RSP11212)
  10. 0.368 Tanao Sri-white 80 (RSP11621)
  11. 0.366 80E (RSP11211)
  12. 0.363 White Label 1 (RSP11336)
  13. 0.360 Northern Lights (RSP11501)
  14. 0.358 RKM-2018-002 (RSP11093)
  15. 0.358 Chematonic Cannatonic x Chemdawg (RSP11394)
  16. 0.358 Tanao Sri-white-T1 (RSP11658)
  17. 0.356 GG4 (RSP11978)
  18. 0.355 Cherry Blossom (RSP11318)
  19. 0.351 RKM-2018-024 (RSP11116)
  20. 0.350 GMO x Zkittlez 43 (RSP11976)

Most genetically distant strains (Base Tree)

0 0.100 0.200 0.300 0.400
clone distance sibling distance more distant
  1. 0.394 Kush Hemp E1 (RSP11128)
  2. 0.378 Cbot-2019-005 (RSP11133)
  3. 0.374 RKM-2018-002 (RSP11093)
  4. 0.352 RKM-2018-026 (RSP11118)
  5. 0.352 Skywalker OG (RSP10837)
  6. 0.343 JL yellow (RSP11075)
  7. 0.340 RKM-2018-028 (RSP11120)
  8. 0.338 RKM-2018-006 (RSP11097)
  9. 0.336 RKM-2018-022 (RSP11114)
  10. 0.335 RKM-2018-032 (RSP11124)
  11. 0.328 RKM-2018-005 (RSP11096)
  12. 0.325 Black Beauty (RSP11035)
  13. 0.323 Cherry (RSP11142)
  14. 0.321 Sour Raspberry (RSP10551)
  15. 0.320 RKM-2018-018 (RSP11110)
  16. 0.319 RKM-2018-027 (RSP11119)
  17. 0.316 Cbot-2019-004 (RSP11132)
  18. 0.312 Hermaphrodite Research Sample1 (RSP11049)
  19. 0.310 RKM-2018-034 (RSP11126)
  20. 0.304 Skunk 18 (RSP11038)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4448796
Overlapping SNPs:
32
Concordance:
25

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495303
Overlapping SNPs:
2
Concordance:
2

Blockchain Registration Information

Transaction ID
3df58faa3f53e6ac1d434fd0a0836a9ccd3bec22c4a96a602434a84be5ff01c2
Stamping Certificate
Download PDF (39.6 KB)
SHASUM Hash
04f9ba2a76fefb7ad0c2257c1b90c2606309202a38fd7a27006ee4378a0dc2d2
QR code for RSP12603

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings