T2R2

RSP 12659

Grower: plant genomic laboratory, medicinal plant research institute, DMSC

General Information

Accession Date
August 10, 2022
Reported Plant Sex
not reported
DNA Extracted From
Unknown

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Uncommon
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type II

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.22%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0360
male female RSP12659

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.323G>A p.Arg108Gln missense variant moderate contig1772 2082549

IGV: Start, Jump

G/A
NGS:
0.004
C90:
0.000
CBDAS c.329G>A p.Arg110Gln missense variant moderate contig1772 2082555

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
CBDAS c.347C>A p.Ser116Tyr missense variant moderate contig1772 2082573

IGV: Start, Jump

C/A
NGS:
0.004
C90:
0.431
CBDAS c.377C>A p.Pro126Gln missense variant moderate contig1772 2082603

IGV: Start, Jump

C/A
NGS:
0.000
C90:
0.000
THCAS c.1229G>A p.Gly410Glu missense variant moderate contig741 4416599

IGV: Start, Jump

C/T
NGS:
0.039
C90:
0.000
THCAS c.373G>C p.Val125Leu missense variant moderate contig741 4417455

IGV: Start, Jump

C/G
NGS:
0.050
C90:
0.000

Variants (Select Genes of Interest)

EMF1-2

UniProt

c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

A/C
NGS:
0.090
C90:
0.474
PHL-2 c.511A>T p.Asn171Tyr missense variant moderate contig2621 339504

IGV: Start, Jump

A/T
NGS:
0.000
C90:
0.000
PHL-2 c.575T>C p.Ile192Thr missense variant moderate contig2621 339568

IGV: Start, Jump

T/C
NGS:
0.009
C90:
0.000
PHL-2 c.841A>T p.Ser281Cys missense variant moderate contig2621 340119

IGV: Start, Jump

A/T
NGS:
0.011
C90:
0.000
PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

A/G
NGS:
0.096
C90:
0.555
PHL-2 c.1096G>A p.Ala366Thr missense variant moderate contig2621 340374

IGV: Start, Jump

G/A
NGS:
0.090
C90:
0.531
PHL-2 c.1115T>G p.Val372Gly missense variant moderate contig2621 340393

IGV: Start, Jump

T/G
NGS:
0.007
C90:
0.000
PHL-2 c.1166C>T p.Pro389Leu missense variant moderate contig2621 340444

IGV: Start, Jump

C/T
NGS:
0.011
C90:
0.057
PHL-2 c.1550A>G p.Asn517Ser missense variant moderate contig2621 340828

IGV: Start, Jump

A/G
NGS:
0.000
C90:
0.000
PHL-2 c.1577A>G p.His526Arg missense variant moderate contig2621 340855

IGV: Start, Jump

A/G
NGS:
0.009
C90:
0.000
PHL-2 c.1658G>T p.Ser553Ile missense variant moderate contig2621 340936

IGV: Start, Jump

G/T
NGS:
0.000
C90:
0.000
PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

T/A
NGS:
0.064
C90:
0.732
PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.746
PHL-2 c.2756A>C p.Glu919Ala missense variant moderate contig2621 342799

IGV: Start, Jump

A/C
NGS:
0.064
C90:
0.675
PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

G/A
NGS:
0.107
C90:
0.890
PHL-2 c.3373A>G p.Thr1125Ala missense variant moderate contig2621 343416

IGV: Start, Jump

A/G
NGS:
0.009
C90:
0.110
PHL-2 c.3467A>G p.Gln1156Arg missense variant moderate contig2621 343510

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.713
PHL-2 c.3556_3557delAA p.Lys1186fs frameshift variant high contig2621 343598

IGV: Start, Jump

GAA/G
NGS:
0.013
C90:
0.096
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2a

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1944273

IGV: Start, Jump

T/C
NGS:
0.101
C90:
0.967
PKSG-2b

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump

C/T
NGS:
0.366
C90:
0.947
PKSG-2b

UniProt

c.718T>A p.Phe240Ile missense variant moderate contig700 1950920

IGV: Start, Jump

A/T
NGS:
0.114
C90:
0.000
PKSG-2b

UniProt

c.592A>G p.Asn198Asp missense variant moderate contig700 1951046

IGV: Start, Jump

T/C
NGS:
0.048
C90:
0.000
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.419A>G p.Asp140Gly missense variant moderate contig700 2721254

IGV: Start, Jump

T/C
NGS:
0.430
C90:
0.440
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
OAC-1

UniProt

c.260C>G p.Ser87Cys missense variant moderate contig931 118104

IGV: Start, Jump

G/C
NGS:
0.053
C90:
0.000
FAD2-2

UniProt

c.161T>A p.Leu54His missense variant moderate contig83 1803208

IGV: Start, Jump

A/T
NGS:
0.156
C90:
0.000
ELF3

UniProt

c.358G>A p.Gly120Arg missense variant moderate contig97 242064

IGV: Start, Jump

G/A
NGS:
0.099
C90:
0.493
ELF3

UniProt

c.520A>C p.Asn174His missense variant moderate contig97 242226

IGV: Start, Jump

A/C
NGS:
0.094
C90:
0.502
ELF3

UniProt

c.574A>G p.Asn192Asp missense variant moderate contig97 242280

IGV: Start, Jump

A/G
NGS:
0.042
C90:
0.579
ELF3

UniProt

c.757C>T p.Pro253Ser missense variant moderate contig97 242463

IGV: Start, Jump

C/T
NGS:
0.020
C90:
0.048
ELF3

UniProt

c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump

A/G
NGS:
0.112
C90:
0.000
ELF3

UniProt

c.811G>A p.Gly271Arg missense variant moderate contig97 242517

IGV: Start, Jump

G/A
NGS:
0.002
C90:
0.000
ELF3

UniProt

c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump

G/C
NGS:
0.114
C90:
0.938
ELF3

UniProt

c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump

G/A
NGS:
0.123
C90:
0.000
ELF3

UniProt

c.1473A>C p.Lys491Asn missense variant moderate contig97 244304

IGV: Start, Jump

A/C
NGS:
0.002
C90:
0.000
ELF3

UniProt

c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.545
ELF3

UniProt

c.1803_1805delTCA p.His601del disruptive inframe deletion moderate contig97 244625

IGV: Start, Jump

ACAT/A
NGS:
0.092
C90:
0.000
ELF3

UniProt

c.1807G>C p.Gly603Arg missense variant moderate contig97 244638

IGV: Start, Jump

G/C
NGS:
0.002
C90:
0.000
ELF3

UniProt

c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump

C/G
NGS:
0.123
C90:
0.632
ELF3

UniProt

c.1982A>C p.Asn661Thr missense variant moderate contig97 244813

IGV: Start, Jump

A/C
NGS:
0.002
C90:
0.000
ELF3

UniProt

c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump

G/T
NGS:
0.125
C90:
0.531
ELF3

UniProt

c.2216A>G p.His739Arg missense variant moderate contig97 245047

IGV: Start, Jump

A/G
NGS:
0.020
C90:
0.182
ELF5

UniProt

c.1162A>G p.Thr388Ala missense variant moderate contig382 881132

IGV: Start, Jump

A/G
NGS:
0.011
C90:
0.033
aPT1

UniProt

c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump

A/G
NGS:
0.579
C90:
0.761
aPT1

UniProt

c.670T>A p.Ser224Thr missense variant moderate contig121 2840278

IGV: Start, Jump

T/A
NGS:
0.077
C90:
0.000
aPT1

UniProt

c.727G>T p.Glu243* stop gained high contig121 2841362

IGV: Start, Jump

G/T
NGS:
0.127
C90:
0.100
aPT1

UniProt

c.864C>G p.Asn288Lys missense variant moderate contig121 2842407

IGV: Start, Jump

C/G
NGS:
0.075
C90:
0.062
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000
HDS-2

UniProt

c.151G>T p.Ala51Ser missense variant moderate contig95 1989818

IGV: Start, Jump

G/T
NGS:
0.011
C90:
0.000
PHL-1

UniProt

c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump

T/C
NGS:
0.123
C90:
0.000
PHL-1

UniProt

c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump

T/C
NGS:
0.116
C90:
0.890
PHL-1

UniProt

c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump

T/C
NGS:
0.107
C90:
0.904
PHL-1

UniProt

c.99G>T p.Glu33Asp missense variant moderate contig1439 1493793

IGV: Start, Jump

C/A
NGS:
0.000
C90:
0.000
Edestin

UniProt

c.130_131insATT p.Gly43_Ser44insTyr conservative inframe insertion moderate contig850 3065159

IGV: Start, Jump

G/GAAT
NGS:
0.009
C90:
0.000
Edestin

UniProt

c.16T>C p.Ser6Pro missense variant moderate contig850 3065274

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.000
HDS-1

UniProt

c.2141G>C p.Gly714Ala missense variant moderate contig1891 884225

IGV: Start, Jump

C/G
NGS:
0.018
C90:
0.000
HDS-1

UniProt

c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump

T/C
NGS:
0.099
C90:
0.861
HDS-1

UniProt

c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump

C/T
NGS:
0.167
C90:
0.000
HDS-1

UniProt

c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump

G/C
NGS:
0.125
C90:
0.943
PIE1-2

UniProt

c.6653A>G p.Asn2218Ser missense variant moderate contig1460 1184434

IGV: Start, Jump

T/C
NGS:
0.059
C90:
0.928
PIE1-2

UniProt

c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump

T/C
NGS:
0.061
C90:
0.268
PIE1-2

UniProt

c.2083_2085delGTC p.Val695del conservative inframe deletion moderate contig1460 1189954

IGV: Start, Jump

GGAC/G
NGS:
0.046
C90:
0.880
PIE1-2

UniProt

c.2072A>G p.His691Arg missense variant moderate contig1460 1189968

IGV: Start, Jump

T/C
NGS:
0.046
C90:
0.789
PIE1-2

UniProt

c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump

A/T
NGS:
0.086
C90:
0.990
PIE1-2

UniProt

c.1656T>G p.Asn552Lys missense variant moderate contig1460 1191574

IGV: Start, Jump

A/C
NGS:
0.009
C90:
0.043
PIE1-2

UniProt

c.1630G>C p.Ala544Pro missense variant moderate contig1460 1191600

IGV: Start, Jump

C/G
NGS:
0.070
C90:
0.933
PIE1-2

UniProt

c.1289A>G p.Asp430Gly missense variant moderate contig1460 1192109

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
PIE1-2

UniProt

c.1243G>C p.Asp415His missense variant moderate contig1460 1192155

IGV: Start, Jump

C/G
NGS:
0.002
C90:
0.000
PIE1-2

UniProt

c.1156T>G p.Trp386Gly missense variant moderate contig1460 1192242

IGV: Start, Jump

A/C
NGS:
0.009
C90:
0.976
PIE1-2

UniProt

c.1117C>G p.Gln373Glu missense variant moderate contig1460 1192281

IGV: Start, Jump

G/C
NGS:
0.002
C90:
0.818
PIE1-2

UniProt

c.1093G>A p.Gly365Ser missense variant moderate contig1460 1192305

IGV: Start, Jump

C/T
NGS:
0.002
C90:
0.986
PIE1-2

UniProt

c.1019_1048dupATGTGGGTGAACCAACCCAGATGGAGGATA p.Asn340_Asp349dup conservative inframe insertion moderate contig1460 1192349

IGV: Start, Jump

C/CTATCCTCCATCTGGGTTGGTTCACCCACAT
NGS:
0.009
C90:
0.000
PIE1-2

UniProt

c.982G>A p.Glu328Lys missense variant moderate contig1460 1192416

IGV: Start, Jump

C/T
NGS:
0.050
C90:
0.976
PIE1-2

UniProt

c.710C>T p.Pro237Leu missense variant moderate contig1460 1193804

IGV: Start, Jump

G/A
NGS:
0.072
C90:
0.866
PIE1-2

UniProt

c.706T>C p.Tyr236His missense variant moderate contig1460 1193808

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.737
PIE1-2

UniProt

c.665+2T>A splice donor variant & intron variant high contig1460 1194391

IGV: Start, Jump

A/T
NGS:
0.009
C90:
0.000
PIE1-2

UniProt

c.637T>A p.Ser213Thr missense variant moderate contig1460 1194421

IGV: Start, Jump

A/T
NGS:
0.079
C90:
0.885
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
FT

UniProt

c.240C>G p.Asn80Lys missense variant moderate contig1561 3124664

IGV: Start, Jump

C/G
NGS:
0.075
C90:
0.000
FLD

UniProt

c.2981T>C p.Met994Thr missense variant moderate contig1450 2044012

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.478
FLD

UniProt

c.2962G>A p.Asp988Asn missense variant moderate contig1450 2044031

IGV: Start, Jump

C/T
NGS:
0.009
C90:
0.000
FLD

UniProt

c.2840A>G p.Asn947Ser missense variant moderate contig1450 2044192

IGV: Start, Jump

T/C
NGS:
0.007
C90:
0.000
FLD

UniProt

c.2585G>A p.Arg862Gln missense variant moderate contig1450 2045075

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
PIE1-1

UniProt

c.773A>G p.Asn258Ser missense variant & splice region variant moderate contig1225 2279897

IGV: Start, Jump

A/G
NGS:
0.033
C90:
0.895
PIE1-1

UniProt

c.811T>C p.Tyr271His missense variant moderate contig1225 2279935

IGV: Start, Jump

T/C
NGS:
0.026
C90:
0.742
PIE1-1

UniProt

c.815C>T p.Pro272Leu missense variant moderate contig1225 2279939

IGV: Start, Jump

C/T
NGS:
0.029
C90:
0.885
PIE1-1

UniProt

c.1124_1153dupATGTGGGTGAACCAACCCAGATGGAGGATA p.Asn375_Asp384dup disruptive inframe insertion moderate contig1225 2281360

IGV: Start, Jump

A/ATGAACCAACCCAGATGGAGGATAATGTGGG
NGS:
0.011
C90:
0.000
PIE1-1

UniProt

c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump

C/G
NGS:
0.096
C90:
0.852
PIE1-1

UniProt

c.1348G>C p.Asp450His missense variant moderate contig1225 2281608

IGV: Start, Jump

G/C
NGS:
0.002
C90:
0.000
PIE1-1

UniProt

c.1394A>G p.Asp465Gly missense variant moderate contig1225 2281654

IGV: Start, Jump

A/G
NGS:
0.007
C90:
0.818
PIE1-1

UniProt

c.1548_1549insATG p.Gln516_Glu517insMet conservative inframe insertion moderate contig1225 2281807

IGV: Start, Jump

A/AGAT
NGS:
0.002
C90:
0.904
PIE1-1

UniProt

c.1758T>G p.Asn586Lys missense variant moderate contig1225 2282186

IGV: Start, Jump

T/G
NGS:
0.007
C90:
0.043
PIE1-1

UniProt

c.2174A>G p.His725Arg missense variant moderate contig1225 2283789

IGV: Start, Jump

A/G
NGS:
0.000
C90:
0.770
PIE1-1

UniProt

c.2185_2187delGTC p.Val729del conservative inframe deletion moderate contig1225 2283796

IGV: Start, Jump

AGTC/A
NGS:
0.000
C90:
0.876
PIE1-1

UniProt

c.3619G>A p.Val1207Met missense variant moderate contig1225 2285234

IGV: Start, Jump

G/A
NGS:
0.042
C90:
0.000
GGR

UniProt

c.53A>G p.Asn18Ser missense variant moderate contig2282 549045

IGV: Start, Jump

A/G
NGS:
0.002
C90:
0.000
GGR

UniProt

c.376G>C p.Glu126Gln missense variant moderate contig2282 549368

IGV: Start, Jump

G/C
NGS:
0.015
C90:
0.110
GGR

UniProt

c.382C>T p.Leu128Phe missense variant moderate contig2282 549374

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.000
GGR

UniProt

c.456T>A p.His152Gln missense variant moderate contig2282 549448

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
GGR

UniProt

c.460G>A p.Asp154Asn missense variant moderate contig2282 549452

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
GGR

UniProt

c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump

A/T
NGS:
0.121
C90:
0.000
GGR

UniProt

c.727T>C p.Tyr243His missense variant moderate contig2282 549719

IGV: Start, Jump

T/C
NGS:
0.002
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.123 T2R4 (RSP12660)
  2. 0.127 T4R2 (RSP12662)
  3. 0.129 T4R15 (RSP12665)
  4. 0.156 T4R4 (RSP12663)
  5. 0.158 T2R15 (RSP12661)
  6. 0.164 T4R6 (RSP12664)
  7. 0.178 Tanao Sri-white 79 (RSP11620)
  8. 0.187 Foithong-F2 (RSP11659)
  9. 0.191 ST (RSP12666)
  10. 0.205 PK (RSP12667)
  11. 0.209 Squirrel Tail 81 (RSP11622)
  12. 0.216 Tanao Sri-white 80 (RSP11621)
  13. 0.222 Squirrel Tail 31 (RSP11485)
  14. 0.228 Tiger Tail 78 (RSP11619)
  15. 0.243 Recon (RSP10755)
  16. 0.251 Tak-HN (RSP11618)
  17. 0.256 Tiger Tail 30 (RSP11484)
  18. 0.258 Liberty Haze (RSP11000)
  19. 0.259 Tanao Sri-white-T1 (RSP11658)
  20. 0.262 Black Jack (RSP10603)

Most genetically distant strains (All Samples)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.474 Cherry Blossom (RSP11323)
  2. 0.457 Cherry Blossom (RSP11301)
  3. 0.441 Cherry Blossom (RSP11318)
  4. 0.439 Cherry Blossom (RSP11328)
  5. 0.428 Cherry Blossom (RSP11331)
  6. 0.424 Cherry Blossom (RSP11312)
  7. 0.422 Unknown- Cherry Wine - 001 (RSP11268)
  8. 0.419 Cherry Blossom (RSP11298)
  9. 0.417 Cherry Blossom (RSP11300)
  10. 0.417 Cherry Blossom (RSP11311)
  11. 0.410 Cherry Blossom (RSP11334)
  12. 0.407 Chematonic Cannatonic x Chemdawg (RSP11394)
  13. 0.406 Chem 91 (RSP11185)
  14. 0.403 Cherry Blossom (RSP11322)
  15. 0.403 JL 4th Gen 2 (RSP11194)
  16. 0.402 JL 4th Gen 5 (RSP11199)
  17. 0.401 Northern Skunk (RSP11456)
  18. 0.401 Cherry Blossom (RSP11309)
  19. 0.401 Cherry Blossom (RSP11333)
  20. 0.399 GMO x Garlic Breath (RSP12507)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8349371
Overlapping SNPs:
93
Concordance:
56

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495160
Overlapping SNPs:
5
Concordance:
5

Blockchain Registration Information

Transaction ID
d9432afc5df03204529acb2700dd5dcf10e223234a753d1d1ccd709ef133c97c
Stamping Certificate
Download PDF (39.7 KB)
SHASUM Hash
85c44a8c60090ce6692e72d5ec04705009c0162fa1470a85c61cc95a9ff7b095
QR code for RSP12659

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings