BF

RSP 12931

Grower: Zamir Punja

General Information

Sample Name
BF - roots from veg plant
Accession Date
September 27, 2023
Reported Plant Sex
Female
Microbiome
Krona Plot

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Unknown

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.42%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0227
male female RSP12931

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

THCAS c.998C>G p.Pro333Arg missense variant moderate contig741 4416830

IGV: Start, Jump

G/C
NGS:
0.182
C90:
0.000
THCAS c.749C>A p.Ala250Asp missense variant moderate contig741 4417079

IGV: Start, Jump

G/T
NGS:
0.127
C90:
0.632

Variants (Select Genes of Interest)

PHL-2 c.44G>A p.Arg15Lys missense variant moderate contig2621 337613

IGV: Start, Jump

G/A
NGS:
0.015
C90:
0.167
PHL-2 c.455A>C p.Asp152Ala missense variant moderate contig2621 339191

IGV: Start, Jump

A/C
NGS:
0.018
C90:
0.507
PHL-2 c.977A>C p.His326Pro missense variant moderate contig2621 340255

IGV: Start, Jump

A/C
NGS:
0.007
C90:
0.000
PHL-2 c.1837G>A p.Glu613Lys missense variant moderate contig2621 341115

IGV: Start, Jump

G/A
NGS:
0.009
C90:
0.000
PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.746
PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

G/A
NGS:
0.107
C90:
0.890
PHL-2 c.2830A>C p.Asn944His missense variant moderate contig2621 342873

IGV: Start, Jump

A/C
NGS:
0.044
C90:
0.000
PHL-2 c.2936T>G p.Val979Gly missense variant moderate contig2621 342979

IGV: Start, Jump

T/G
NGS:
0.048
C90:
0.000
PHL-2 c.3209A>G p.Gln1070Arg missense variant moderate contig2621 343252

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.885
PHL-2 c.3467A>G p.Gln1156Arg missense variant moderate contig2621 343510

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.713
PKSG-2a

UniProt

c.948T>G p.Asp316Glu missense variant moderate contig700 1944442

IGV: Start, Jump

A/C
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.945T>G p.Ser315Arg missense variant moderate contig700 1944445

IGV: Start, Jump

A/C
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.944G>A p.Ser315Asn missense variant moderate contig700 1944446

IGV: Start, Jump

C/T
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1944456

IGV: Start, Jump

G/C
NGS:
0.070
C90:
0.000
PKSG-2b

UniProt

c.67A>T p.Ile23Phe missense variant moderate contig700 1951815

IGV: Start, Jump

T/A
NGS:
0.033
C90:
0.325
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.316+2T>A splice donor variant & intron variant high contig700 2723818

IGV: Start, Jump

A/T
NGS:
0.070
C90:
0.689
AAE1-1

UniProt

c.696_697dupAG p.Gly233fs frameshift variant high contig606 3243573

IGV: Start, Jump

C/CCT
NGS:
0.002
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
DXR-2

UniProt

c.1041delC p.Met348fs frameshift variant high contig380 286011

IGV: Start, Jump

TG/T
NGS:
0.000
C90:
0.000
FAD2-2

UniProt

c.196T>C p.Phe66Leu missense variant moderate contig83 1803173

IGV: Start, Jump

A/G
NGS:
0.033
C90:
0.000
FAD2-2

UniProt

c.172G>T p.Asp58Tyr missense variant moderate contig83 1803197

IGV: Start, Jump

C/A
NGS:
0.070
C90:
0.000
FAD2-2

UniProt

c.161T>A p.Leu54His missense variant moderate contig83 1803208

IGV: Start, Jump

A/T
NGS:
0.156
C90:
0.000
ELF4

UniProt

c.144T>A p.Asp48Glu missense variant moderate contig869 622426

IGV: Start, Jump

A/T
NGS:
0.031
C90:
0.000
ELF3

UniProt

c.358G>A p.Gly120Arg missense variant moderate contig97 242064

IGV: Start, Jump

G/A
NGS:
0.099
C90:
0.493
ELF3

UniProt

c.1230-2_1230-1delAG splice acceptor variant & intron variant high contig97 243676

IGV: Start, Jump

TAG/T
NGS:
0.088
C90:
0.450
ELF3

UniProt

c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump

G/A
NGS:
0.123
C90:
0.000
ELF3

UniProt

c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.545
ELF3

UniProt

c.2141C>G p.Pro714Arg missense variant moderate contig97 244972

IGV: Start, Jump

C/G
NGS:
0.088
C90:
0.335
aPT4

UniProt

c.35A>C p.Gln12Pro missense variant moderate contig121 2828691

IGV: Start, Jump

A/C
NGS:
0.075
C90:
0.000
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
AAE1-2

UniProt

c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump

A/G
NGS:
0.123
C90:
0.000
AAE1-2

UniProt

c.688G>A p.Asp230Asn missense variant moderate contig81 209650

IGV: Start, Jump

G/A
NGS:
0.018
C90:
0.000
AAE1-2

UniProt

c.1434G>T p.Glu478Asp missense variant moderate contig81 210396

IGV: Start, Jump

G/T
NGS:
0.075
C90:
0.000
PHL-1

UniProt

c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump

T/C
NGS:
0.123
C90:
0.000
PHL-1

UniProt

c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump

T/C
NGS:
0.116
C90:
0.890
PHL-1

UniProt

c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump

T/C
NGS:
0.107
C90:
0.904
TFL1

UniProt

c.302-1G>A splice acceptor variant & intron variant high contig1636 520616

IGV: Start, Jump

C/T
NGS:
0.103
C90:
0.794
HDS-1

UniProt

c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump

G/C
NGS:
0.125
C90:
0.943
HDS-1

UniProt

c.35G>A p.Cys12Tyr missense variant moderate contig1891 889357

IGV: Start, Jump

C/T
NGS:
0.094
C90:
0.646
HDS-1

UniProt

c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump

A/AC
NGS:
0.217
C90:
0.000
PIE1-2

UniProt

c.6773T>C p.Leu2258Ser missense variant moderate contig1460 1184314

IGV: Start, Jump

A/G
NGS:
0.046
C90:
0.675
PIE1-2

UniProt

c.1326_1335delAAAGGATGAC p.Lys443fs frameshift variant high contig1460 1192062

IGV: Start, Jump

CGTCATCCTTT/C
NGS:
0.000
C90:
0.000
PIE1-2

UniProt

c.1289_1323delATGGGGATCAACCAGCCCAGATGGAGGGTAATCCA p.Asp430fs frameshift variant high contig1460 1192074

IGV: Start, Jump

CTGGATTACCCTCCATCTGGGCTGGTTGATCCCCAT/C
NGS:
0.000
C90:
0.000
PIE1-2

UniProt

c.1289A>G p.Asp430Gly missense variant moderate contig1460 1192109

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
FT

UniProt

c.190G>A p.Val64Ile missense variant moderate contig1561 3124614

IGV: Start, Jump

G/A
NGS:
0.000
C90:
0.000
FT

UniProt

c.333delG p.Cys112fs frameshift variant high contig1561 3126369

IGV: Start, Jump

TG/T
NGS:
0.000
C90:
0.000
FT

UniProt

c.421_422dupTA p.Leu142fs frameshift variant high contig1561 3126659

IGV: Start, Jump

C/CTA
NGS:
0.000
C90:
0.000
FT

UniProt

c.424C>A p.Leu142Ile missense variant moderate contig1561 3126663

IGV: Start, Jump

C/A
NGS:
0.000
C90:
0.000
FLD

UniProt

c.2981T>C p.Met994Thr missense variant moderate contig1450 2044012

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.478
FLD

UniProt

c.2964C>A p.Asp988Glu missense variant moderate contig1450 2044029

IGV: Start, Jump

G/T
NGS:
0.057
C90:
0.464
FLD

UniProt

c.2929T>C p.Phe977Leu missense variant moderate contig1450 2044103

IGV: Start, Jump

A/G
NGS:
0.026
C90:
0.349
FLD

UniProt

c.125G>A p.Ser42Asn missense variant moderate contig1450 2047909

IGV: Start, Jump

C/T
NGS:
0.037
C90:
0.388
AAE1-3

UniProt

c.667G>A p.Val223Ile missense variant moderate contig976 1083187

IGV: Start, Jump

C/T
NGS:
0.048
C90:
0.000
AAE1-3

UniProt

c.475G>A p.Gly159Arg missense variant moderate contig976 1083550

IGV: Start, Jump

C/T
NGS:
0.048
C90:
0.000
AAE1-3

UniProt

c.416T>C p.Leu139Pro missense variant moderate contig976 1083609

IGV: Start, Jump

A/G
NGS:
0.061
C90:
0.000
AAE1-3

UniProt

c.382T>C p.Tyr128His missense variant moderate contig976 1083643

IGV: Start, Jump

A/G
NGS:
0.072
C90:
0.000
AAE1-3

UniProt

c.296C>T p.Pro99Leu missense variant moderate contig976 1083729

IGV: Start, Jump

G/A
NGS:
0.046
C90:
0.000
AAE1-3

UniProt

c.293A>G p.Asp98Gly missense variant moderate contig976 1083732

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.284A>T p.Glu95Val missense variant moderate contig976 1083741

IGV: Start, Jump

T/A
NGS:
0.053
C90:
0.000
AAE1-3

UniProt

c.181G>A p.Val61Ile missense variant moderate contig976 1083894

IGV: Start, Jump

C/T
NGS:
0.055
C90:
0.000
AAE1-3

UniProt

c.167A>G p.Glu56Gly missense variant moderate contig976 1083908

IGV: Start, Jump

T/C
NGS:
0.070
C90:
0.000
AAE1-3

UniProt

c.125A>G p.Glu42Gly missense variant moderate contig976 1083950

IGV: Start, Jump

T/C
NGS:
0.064
C90:
0.000
AAE1-3

UniProt

c.79A>G p.Thr27Ala missense variant moderate contig976 1083996

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.52G>A p.Gly18Ser missense variant moderate contig976 1084023

IGV: Start, Jump

C/T
NGS:
0.064
C90:
0.000
PIE1-1

UniProt

c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump

C/G
NGS:
0.096
C90:
0.852
GGR

UniProt

c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump

A/T
NGS:
0.121
C90:
0.000
PKSB-3

UniProt

c.1850_1852dupTGA p.Met617dup disruptive inframe insertion moderate contig93 3339945

IGV: Start, Jump

A/AGAT
NGS:
0.031
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.092 BF (RSP12937)
  2. 0.193 Sunday Driver (RSP11071)
  3. 0.196 JFG (RSP12927)
  4. 0.201 Blueberry Cheesecake (RSP10684)
  5. 0.206 Powdered Donuts (RSP12939)
  6. 0.216 Hermaphrodite ResearchSample2 (RSP11050)
  7. 0.220 JFG (RSP12933)
  8. 0.224 Old Family Purple (RSP12098)
  9. 0.225 PG (RSP12934)
  10. 0.225 Durban Poison 1 (RSP11013)
  11. 0.229 Liberty Haze (RSP11000)
  12. 0.231 Rest (RSP11377)
  13. 0.231 501st OG (RSP11241)
  14. 0.233 PG (RSP12928)
  15. 0.233 Pie Hoe (RSP11073)
  16. 0.234 unknown (RSP11432)
  17. 0.234 Sour Tsunami x Cataract Ku (RSP11183)
  18. 0.235 Serious Happiness (RSP10763)
  19. 0.236 Trump x Trump (RSP11466)
  20. 0.236 Electra (RSP11366)

Nearest genetic relatives (Base Tree)

0 0.083 0.167 0.250 0.333
clone distance sibling distance more distant
  1. 0.200 Blueberry Cheesecake (RSP10684)
  2. 0.229 Hermaphrodite ResearchSample2 (RSP11050)
  3. 0.232 Durban Poison (RSP11014)
  4. 0.248 Pie Hoe (RSP11073)
  5. 0.250 Skywalker OG (RSP10837)
  6. 0.254 Liberty Haze (RSP11000)
  7. 0.272 RKM-2018-033 (RSP11125)
  8. 0.279 RKM-2018-002 (RSP11093)
  9. 0.283 RKM-2018-004 (RSP11096)
  10. 0.285 Blueberry Cheesecake (RSP10680)
  11. 0.287 RKM-2018-034 (RSP11126)
  12. 0.288 CST (RSP11002)
  13. 0.289 UP Sunrise (RSP10989)
  14. 0.290 RKM-2018-020 (RSP11112)
  15. 0.291 Hermaphrodite Research Sample1 (RSP11049)
  16. 0.291 RKM-2018-029 (RSP11121)
  17. 0.294 The Gift (RSP10988)
  18. 0.299 RKM-2018-032 (RSP11124)
  19. 0.301 Kimbo Slice (RSP10997)
  20. 0.305 RKM-2018-003 (RSP11094)

Most genetically distant strains (All Samples)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.443 Northern Skunk (RSP11456)
  2. 0.428 Cherry Blossom (RSP11323)
  3. 0.426 Cherry Blossom (RSP11318)
  4. 0.408 JL 3rd Gen Father (RSP11196)
  5. 0.405 Cherry Blossom (RSP11311)
  6. 0.404 Unknown- Cherry Wine - 001 (RSP11268)
  7. 0.401 Cherry Blossom (RSP11334)
  8. 0.399 CS Indica (RSP11658)
  9. 0.399 Cherry Blossom (RSP11333)
  10. 0.397 Cherry Blossom (RSP11301)
  11. 0.394 Cherry Blossom (RSP11314)
  12. 0.394 Jamaican Lion (RSP12913)
  13. 0.393 80E (RSP11213)
  14. 0.393 CS (RSP11208)
  15. 0.393 Cherry Blossom (RSP11324)
  16. 0.392 Cherry Blossom (RSP11306)
  17. 0.391 Jamaican Lion (RSP12916)
  18. 0.388 HM (RSP12940)
  19. 0.385 Cherry Fog XL (RSP11458)
  20. 0.385 Cherry Blossom (RSP11328)

Most genetically distant strains (Base Tree)

0 0.100 0.200 0.300 0.400
clone distance sibling distance more distant
  1. 0.388 JL yellow (RSP11075)
  2. 0.385 Cbot-2019-005 (RSP11133)
  3. 0.374 Fedora 17 (RSP10661)
  4. 0.363 Futura 75 (RSP10664)
  5. 0.362 RKM-2018-022 (RSP11114)
  6. 0.359 Carmagnola (RSP11037)
  7. 0.358 Lovrin (RSP10658)
  8. 0.358 Black Beauty (RSP11035)
  9. 0.357 Kush Hemp E1 (RSP11128)
  10. 0.357 Monoica (RSP10241)
  11. 0.357 USO 31 (RSP10981)
  12. 0.353 Cherry (RSP11142)
  13. 0.349 Santhica27 (RSP11047)
  14. 0.341 RKM-2018-019 (RSP11111)
  15. 0.339 Ivory (RSP10668)
  16. 0.335 RKM-2018-027 (RSP11119)
  17. 0.334 Tisza (RSP11044)
  18. 0.334 Carmagnola (RSP10979)
  19. 0.333 Kyrgyz Gold (RSP11054)
  20. 0.332 RKM-2018-006 (RSP11097)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8346464
Overlapping SNPs:
94
Concordance:
57

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495250
Overlapping SNPs:
3
Concordance:
3

Blockchain Registration Information

Transaction ID
7ab76627e80330bad7afa9643fab5fe7254204dffe8b618c9aa6a1297a88c3c3
Stamping Certificate
Download PDF (39.6 KB)
SHASUM Hash
988be9bbd10019eab8a85ef5a47e4727f3f243b88fa77ef00a14b46ebb9ddf03
QR code for RSP12931

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings