UC_70

SRR 14419679

Grower: Colorado State University, Patrick Woods

General Information

Accession Date
April 18, 2021
Reported Plant Sex
not reported

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Common
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

THC + THCA
0.0011%
CBD + CBDA
0.0378%
THCV + THCVA
n/a
CBC + CBCA
0.%
CBG + CBGA
0.0009%
CBN + CBNA
n/a

Terpenoids

α-Bisabolol
n/a
Borneol
n/a
Camphene
0.0001%
Carene
0.%
Caryophyllene oxide
0.0011%
β-Caryophyllene
0.0014%
Fenchol
n/a
Geraniol
0.%
α-Humulene
n/a
Limonene
n/a
Linalool
0.%
Myrcene
n/a
α-Phellandrene
n/a
Terpinolene
n/a
α-Terpineol
n/a
α-Terpinene
0.0002%
γ-Terpinene
0.0001%
Total Nerolidol
n/a
Total Ocimene
0.%
α-Pinene
0.0043%
β-Pinene
n/a

Genetic Information

Plant Type
Type II

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.6%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0299
male female SRR14419679

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.221C>G p.Thr74Ser missense variant moderate contig1772 2082447

IGV: Start, Jump

C/G
NGS:
0.136
C90:
0.057
CBDAS c.503A>G p.Asn168Ser missense variant moderate contig1772 2082729

IGV: Start, Jump

A/G
NGS:
0.024
C90:
0.062
CBDAS c.587A>G p.Asn196Ser missense variant moderate contig1772 2082813

IGV: Start, Jump

A/G
NGS:
0.011
C90:
0.435
CBDAS c.1420A>C p.Lys474Gln missense variant moderate contig1772 2083646

IGV: Start, Jump

A/C
NGS:
0.132
C90:
0.813

Variants (Select Genes of Interest)

GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
EMF1-2

UniProt

c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

A/C
NGS:
0.090
C90:
0.474
PHL-2 c.932T>C p.Leu311Pro missense variant moderate contig2621 340210

IGV: Start, Jump

T/C
NGS:
0.039
C90:
0.268
PHL-2 c.1096G>A p.Ala366Thr missense variant moderate contig2621 340374

IGV: Start, Jump

G/A
NGS:
0.090
C90:
0.531
PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

T/A
NGS:
0.064
C90:
0.732
PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.746
PHL-2 c.2624C>T p.Ser875Phe missense variant moderate contig2621 342667

IGV: Start, Jump

C/T
NGS:
0.042
C90:
0.268
PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

G/A
NGS:
0.107
C90:
0.890
PHL-2 c.2830A>C p.Asn944His missense variant moderate contig2621 342873

IGV: Start, Jump

A/C
NGS:
0.044
C90:
0.000
PHL-2 c.2933G>T p.Arg978Leu missense variant moderate contig2621 342976

IGV: Start, Jump

G/T
NGS:
0.048
C90:
0.297
PHL-2 c.2936T>G p.Val979Gly missense variant moderate contig2621 342979

IGV: Start, Jump

T/G
NGS:
0.048
C90:
0.000
PHL-2 c.3209A>G p.Gln1070Arg missense variant moderate contig2621 343252

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.885
PHL-2 c.3467A>G p.Gln1156Arg missense variant moderate contig2621 343510

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.713
PKSG-4a

UniProt

c.493G>A p.Gly165Ser missense variant moderate contig700 1937904

IGV: Start, Jump

G/A
NGS:
0.103
C90:
0.000
PKSG-4b

UniProt

c.535_545delATTGGAGTGGG p.Ile179fs frameshift variant high contig700 2721127

IGV: Start, Jump

CCCCACTCCAAT/C
NGS:
0.105
C90:
0.000
PKSG-4b

UniProt

c.523C>T p.His175Tyr missense variant moderate contig700 2721150

IGV: Start, Jump

G/A
NGS:
0.112
C90:
0.325
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.353_354insCC p.Gly119fs frameshift variant high contig700 2721319

IGV: Start, Jump

T/TGG
NGS:
0.175
C90:
0.000
PKSG-4b

UniProt

c.316+2T>A splice donor variant & intron variant high contig700 2723818

IGV: Start, Jump

A/T
NGS:
0.070
C90:
0.689
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
OAC-1

UniProt

c.260C>G p.Ser87Cys missense variant moderate contig931 118104

IGV: Start, Jump

G/C
NGS:
0.053
C90:
0.000
FAD2-2

UniProt

c.161T>A p.Leu54His missense variant moderate contig83 1803208

IGV: Start, Jump

A/T
NGS:
0.156
C90:
0.000
FAD2-2

UniProt

c.127C>T p.Arg43* stop gained high contig83 1803242

IGV: Start, Jump

G/A
NGS:
0.000
C90:
0.000
FAD2-2

UniProt

c.110C>T p.Ala37Val missense variant moderate contig83 1803259

IGV: Start, Jump

G/A
NGS:
0.013
C90:
0.000
FAD2-2

UniProt

c.75C>A p.His25Gln missense variant moderate contig83 1803294

IGV: Start, Jump

G/T
NGS:
0.007
C90:
0.000
ELF3

UniProt

c.364_366delAAG p.Lys122del conservative inframe deletion moderate contig97 242066

IGV: Start, Jump

AAAG/A
NGS:
0.004
C90:
0.000
ELF3

UniProt

c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump

A/G
NGS:
0.112
C90:
0.000
ELF3

UniProt

c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump

G/C
NGS:
0.114
C90:
0.938
ELF3

UniProt

c.1366T>G p.Leu456Val missense variant moderate contig97 244197

IGV: Start, Jump

T/G
NGS:
0.015
C90:
0.000
ELF3

UniProt

c.1435G>C p.Ala479Pro missense variant moderate contig97 244266

IGV: Start, Jump

G/C
NGS:
0.004
C90:
0.000
ELF3

UniProt

c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump

G/A
NGS:
0.123
C90:
0.000
ELF3

UniProt

c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.545
ELF3

UniProt

c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump

C/G
NGS:
0.123
C90:
0.632
ELF3

UniProt

c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump

G/T
NGS:
0.125
C90:
0.531
aPT1

UniProt

c.574A>T p.Met192Leu missense variant moderate contig121 2840182

IGV: Start, Jump

A/T
NGS:
0.024
C90:
0.000
aPT1

UniProt

c.629C>T p.Thr210Ile missense variant moderate contig121 2840237

IGV: Start, Jump

C/T
NGS:
0.561
C90:
0.598
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000
AAE1-2

UniProt

c.146delA p.Asn49fs frameshift variant high contig81 209105

IGV: Start, Jump

TA/T
NGS:
0.000
C90:
0.000
AAE1-2

UniProt

c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump

A/G
NGS:
0.123
C90:
0.000
AAE1-2

UniProt

c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump

A/G
NGS:
0.116
C90:
0.000
PHL-1

UniProt

c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump

T/C
NGS:
0.123
C90:
0.000
PHL-1

UniProt

c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump

T/C
NGS:
0.116
C90:
0.890
PHL-1

UniProt

c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump

T/C
NGS:
0.107
C90:
0.904
Edestin

UniProt

c.40G>A p.Ala14Thr missense variant moderate contig850 3065250

IGV: Start, Jump

C/T
NGS:
0.011
C90:
0.000
Edestin

UniProt

c.17C>T p.Ser6Leu missense variant moderate contig850 3065273

IGV: Start, Jump

G/A
NGS:
0.011
C90:
0.000
Edestin

UniProt

c.16T>C p.Ser6Pro missense variant moderate contig850 3065274

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.000
HDS-1

UniProt

c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump

T/C
NGS:
0.099
C90:
0.861
HDS-1

UniProt

c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump

C/T
NGS:
0.167
C90:
0.000
PIE1-2

UniProt

c.6653A>G p.Asn2218Ser missense variant moderate contig1460 1184434

IGV: Start, Jump

T/C
NGS:
0.059
C90:
0.928
PIE1-2

UniProt

c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump

T/C
NGS:
0.061
C90:
0.268
PIE1-2

UniProt

c.5884G>A p.Gly1962Ser missense variant moderate contig1460 1185715

IGV: Start, Jump

C/T
NGS:
0.004
C90:
0.019
PIE1-2

UniProt

c.2188G>A p.Ala730Thr missense variant moderate contig1460 1189852

IGV: Start, Jump

C/T
NGS:
0.004
C90:
0.134
PIE1-2

UniProt

c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump

A/T
NGS:
0.086
C90:
0.990
PIE1-2

UniProt

c.1289A>G p.Asp430Gly missense variant moderate contig1460 1192109

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
PIE1-2

UniProt

c.1156T>G p.Trp386Gly missense variant moderate contig1460 1192242

IGV: Start, Jump

A/C
NGS:
0.009
C90:
0.976
PIE1-2

UniProt

c.982G>A p.Glu328Lys missense variant moderate contig1460 1192416

IGV: Start, Jump

C/T
NGS:
0.050
C90:
0.976
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
EMF1-1

UniProt

c.627_629dupTGT p.Val210dup disruptive inframe insertion moderate contig883 270231

IGV: Start, Jump

A/ATGT
NGS:
0.007
C90:
0.000
FT

UniProt

c.413_413+1insGTATGCA splice donor variant & intron variant high contig1561 3126450

IGV: Start, Jump

T/TGTATGCA
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.667G>A p.Val223Ile missense variant moderate contig976 1083187

IGV: Start, Jump

C/T
NGS:
0.048
C90:
0.000
AAE1-3

UniProt

c.655C>T p.Pro219Ser missense variant moderate contig976 1083199

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.635G>A p.Gly212Asp missense variant moderate contig976 1083219

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump

C/G
NGS:
0.116
C90:
0.000
AAE1-3

UniProt

c.483_484insACT p.Thr161dup conservative inframe insertion moderate contig976 1083541

IGV: Start, Jump

C/CAGT
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.480_481insGTAAAAATCCTCCTCTTAATTTCTTACAGCTCTTTAATCTTTTACTATTTTATTGGTTGCTGAAAACCTCGGTCA p.Asn160_Thr161insValLysIleLeuLeuLeuIleSerTyrSerSerLeuIlePheTyrTyrPheIleGlyCysTerLysProArgSer stop gained & conservative inframe insertion high contig976 1083544

IGV: Start, Jump

T/TTGACCGAGGTTTTCAGCAACCAATAAAATAGTAAAAGATTAAAGAGCTGTAAGAAATTAAGAGGAGGATTTTTAC
NGS:
0.000
C90:
0.000
AAE1-3

UniProt

c.475G>A p.Gly159Arg missense variant moderate contig976 1083550

IGV: Start, Jump

C/T
NGS:
0.048
C90:
0.000
AAE1-3

UniProt

c.416T>C p.Leu139Pro missense variant moderate contig976 1083609

IGV: Start, Jump

A/G
NGS:
0.061
C90:
0.000
AAE1-3

UniProt

c.403G>T p.Asp135Tyr missense variant moderate contig976 1083622

IGV: Start, Jump

C/A
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.382T>C p.Tyr128His missense variant moderate contig976 1083643

IGV: Start, Jump

A/G
NGS:
0.072
C90:
0.000
AAE1-3

UniProt

c.367C>T p.Arg123Trp missense variant moderate contig976 1083658

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.296C>T p.Pro99Leu missense variant moderate contig976 1083729

IGV: Start, Jump

G/A
NGS:
0.046
C90:
0.000
AAE1-3

UniProt

c.293A>G p.Asp98Gly missense variant moderate contig976 1083732

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.284A>T p.Glu95Val missense variant moderate contig976 1083741

IGV: Start, Jump

T/A
NGS:
0.053
C90:
0.000
AAE1-3

UniProt

c.267T>G p.His89Gln missense variant moderate contig976 1083758

IGV: Start, Jump

A/C
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.224C>T p.Pro75Leu missense variant moderate contig976 1083851

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.208G>C p.Ala70Pro missense variant moderate contig976 1083867

IGV: Start, Jump

C/G
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.181G>A p.Val61Ile missense variant moderate contig976 1083894

IGV: Start, Jump

C/T
NGS:
0.055
C90:
0.000
AAE1-3

UniProt

c.167A>G p.Glu56Gly missense variant moderate contig976 1083908

IGV: Start, Jump

T/C
NGS:
0.070
C90:
0.000
AAE1-3

UniProt

c.154G>A p.Val52Ile missense variant moderate contig976 1083921

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.125A>G p.Glu42Gly missense variant moderate contig976 1083950

IGV: Start, Jump

T/C
NGS:
0.064
C90:
0.000
AAE1-3

UniProt

c.101A>G p.Tyr34Cys missense variant moderate contig976 1083974

IGV: Start, Jump

T/C
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.79A>G p.Thr27Ala missense variant moderate contig976 1083996

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.52G>A p.Gly18Ser missense variant moderate contig976 1084023

IGV: Start, Jump

C/T
NGS:
0.064
C90:
0.000
AAE1-3

UniProt

c.12G>A p.Met4Ile missense variant moderate contig976 1084063

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.11T>C p.Met4Thr missense variant moderate contig976 1084064

IGV: Start, Jump

A/G
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.3G>A p.Met1? start lost high contig976 1084072

IGV: Start, Jump

C/T
NGS:
0.046
C90:
0.416
FAD7A-1

UniProt

c.691G>A p.Gly231Ser missense variant moderate contig510 69995

IGV: Start, Jump

G/A
NGS:
0.000
C90:
0.000
PIE1-1

UniProt

c.3706A>G p.Thr1236Ala missense variant moderate contig1225 2285321

IGV: Start, Jump

A/G
NGS:
0.004
C90:
0.000
GGR

UniProt

c.376G>C p.Glu126Gln missense variant moderate contig2282 549368

IGV: Start, Jump

G/C
NGS:
0.015
C90:
0.110
GGR

UniProt

c.382C>T p.Leu128Phe missense variant moderate contig2282 549374

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.000
GGR

UniProt

c.456T>A p.His152Gln missense variant moderate contig2282 549448

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
GGR

UniProt

c.460G>A p.Asp154Asn missense variant moderate contig2282 549452

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
GGR

UniProt

c.581C>T p.Ala194Val missense variant moderate contig2282 549573

IGV: Start, Jump

C/T
NGS:
0.015
C90:
0.105
GGR

UniProt

c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump

A/T
NGS:
0.121
C90:
0.000
GGR

UniProt

c.810A>C p.Glu270Asp missense variant moderate contig2282 549802

IGV: Start, Jump

A/C
NGS:
0.007
C90:
0.000
PKSB-3

UniProt

c.509T>C p.Val170Ala missense variant & splice region variant moderate contig93 3336743

IGV: Start, Jump

T/C
NGS:
0.011
C90:
0.000
PKSB-3

UniProt

c.1490C>T p.Ala497Val missense variant moderate contig93 3339597

IGV: Start, Jump

C/T
NGS:
0.011
C90:
0.000
PKSB-3

UniProt

c.1652A>G p.Glu551Gly missense variant moderate contig93 3339759

IGV: Start, Jump

A/G
NGS:
0.088
C90:
0.000
PKSB-3

UniProt

c.1848G>A p.Met616Ile missense variant moderate contig93 3339955

IGV: Start, Jump

G/A
NGS:
0.009
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.033 0.067 0.100 0.133
clone distance sibling distance more distant
  1. 0.076 VIR 483 (SRR14708238)
  2. 0.092 VIR 37 - Novgorod-Seversky - cv (SRR14708234)
  3. 0.097 Kompolti (SRR14708277)
  4. 0.106 PCL1 (SRR14708246)
  5. 0.108 R2in135 (SRR14708236)
  6. 0.108 B52 (SRR14708255)
  7. 0.109 Doug s Varin (RSP11243)
  8. 0.110 Tiborszallasi (SRR14708273)
  9. 0.111 Lift (RSP11378)
  10. 0.111 UC 167 (SRR14419585)
  11. 0.111 VIR 369 (SRR14708231)
  12. 0.113 Electra (RSP11366)
  13. 0.114 VIR 483 (SRR14708240)
  14. 0.118 IUL3 (SRR14708252)
  15. 0.118 Hawaii Maui Waui (SRR14708262)
  16. 0.119 Whitey (RSP11363)
  17. 0.120 Carmagnola (SRR14708200)
  18. 0.120 Domnesia (RSP11184)
  19. 0.121 Durban Poison 1 (RSP10996)
  20. 0.121 Suver Haze (RSP11364)

Most genetically distant strains (All Samples)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.452 JL yellow (RSP11075)
  2. 0.430 JL 3rd Gen Mother (RSP11214)
  3. 0.425 80E (RSP11213)
  4. 0.404 JL 4th Gen 2 (RSP11194)
  5. 0.402 JL 4th Gen 5 (RSP11199)
  6. 0.396 JL 4th Gen 1 (RSP11193)
  7. 0.387 80E (RSP11211)
  8. 0.376 JL 3rd Gen Mother (RSP11197)
  9. 0.368 Danny Noonan (RSP11070)
  10. 0.365 Chematonic Cannatonic x Chemdawg (RSP11394)
  11. 0.361 80E (RSP11212)
  12. 0.359 UC 170 (SRR14419582)
  13. 0.358 JL 4th Gen 4 (RSP11198)
  14. 0.349 Skunk 18 (RSP11038)
  15. 0.349 Chem 91 (RSP11185)
  16. 0.349 Carmaleonte (RSP11207)
  17. 0.349 Feral (RSP11205)
  18. 0.347 Futura 75 (RSP10664)
  19. 0.347 Cbot-2019-005 (RSP11133)
  20. 0.344 R4 (RSP11617)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8349325
Overlapping SNPs:
17
Concordance:
13

Blockchain Registration Information

SHASUM Hash
1361983db67b6bed49c7e9fc9a8741b941f035cdb81499229c077d99d2e90d77
QR code for SRR14419679

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings