GXI

SRR 14708198

Grower: Lanzhou University, Guangpeng Ren

General Information

Accession Date
May 31, 2021
Reported Plant Sex
unknown

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type I

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.35%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0208
male female SRR14708198

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
THCAS c.373G>C p.Val125Leu missense variant moderate contig741 4417455

IGV: Start, Jump

C/G
NGS:
0.050
C90:
0.000

Variants (Select Genes of Interest)

GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
GPPs1

UniProt

c.885G>A p.Met295Ile missense variant & splice region variant moderate contig676 169675

IGV: Start, Jump

G/A
NGS:
0.002
C90:
0.000
GPPs1

UniProt

c.896A>G p.Asn299Ser missense variant moderate contig676 169772

IGV: Start, Jump

A/G
NGS:
0.046
C90:
0.000
GPPs1

UniProt

c.923_927+2delTTTTGGT p.Val308fs frameshift variant & splice donor variant & splice region variant & intron variant high contig676 169798

IGV: Start, Jump

GTTTTGGT/G
NGS:
0.000
C90:
0.000
EMF1-2

UniProt

c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

A/C
NGS:
0.090
C90:
0.474
PHL-2 c.575T>C p.Ile192Thr missense variant moderate contig2621 339568

IGV: Start, Jump

T/C
NGS:
0.009
C90:
0.000
PHL-2 c.841A>T p.Ser281Cys missense variant moderate contig2621 340119

IGV: Start, Jump

A/T
NGS:
0.011
C90:
0.000
PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

A/G
NGS:
0.096
C90:
0.555
PHL-2 c.1096G>A p.Ala366Thr missense variant moderate contig2621 340374

IGV: Start, Jump

G/A
NGS:
0.090
C90:
0.531
PHL-2 c.1115T>G p.Val372Gly missense variant moderate contig2621 340393

IGV: Start, Jump

T/G
NGS:
0.007
C90:
0.000
PHL-2 c.1166C>T p.Pro389Leu missense variant moderate contig2621 340444

IGV: Start, Jump

C/T
NGS:
0.011
C90:
0.057
PHL-2 c.1577A>G p.His526Arg missense variant moderate contig2621 340855

IGV: Start, Jump

A/G
NGS:
0.009
C90:
0.000
PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

G/A
NGS:
0.107
C90:
0.890
PHL-2 c.3490G>C p.Val1164Leu missense variant moderate contig2621 343533

IGV: Start, Jump

G/C
NGS:
0.000
C90:
0.000
PHL-2 c.3494C>T p.Ser1165Leu missense variant moderate contig2621 343537

IGV: Start, Jump

C/T
NGS:
0.000
C90:
0.000
PKSG-4b

UniProt

c.509_510insCCATATTAAGGGCAATTAAGTTTTTATGCCATATATATCAAAACATATCTTCATTTTCCCATATTTTTGTAAATAGCCC p.Lys171fs frameshift variant & stop gained high contig700 2721163

IGV: Start, Jump

T/TGGGCTATTTACAAAAATATGGGAAAATGAAGATATGTTTTGATATATATGGCATAAAAACTTAATTGCCCTTAATATGG
NGS:
0.000
C90:
0.000
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.419A>G p.Asp140Gly missense variant moderate contig700 2721254

IGV: Start, Jump

T/C
NGS:
0.430
C90:
0.440
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.353_354insCC p.Gly119fs frameshift variant high contig700 2721319

IGV: Start, Jump

T/TGG
NGS:
0.175
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
PKSG-4b

UniProt

c.316+2T>A splice donor variant & intron variant high contig700 2723818

IGV: Start, Jump

A/T
NGS:
0.070
C90:
0.689
PKSG-4b

UniProt

c.229G>A p.Gly77Ser missense variant moderate contig700 2724206

IGV: Start, Jump

C/T
NGS:
0.042
C90:
0.000
PKSG-4b

UniProt

c.216G>C p.Leu72Phe missense variant moderate contig700 2724219

IGV: Start, Jump

C/G
NGS:
0.044
C90:
0.000
PKSG-4b

UniProt

c.206T>C p.Leu69Ser missense variant moderate contig700 2724229

IGV: Start, Jump

A/G
NGS:
0.044
C90:
0.000
PKSG-4b

UniProt

c.100C>T p.Arg34Trp missense variant moderate contig700 2724335

IGV: Start, Jump

G/A
NGS:
0.000
C90:
0.000
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
FAD2-2

UniProt

c.311C>T p.Ala104Val missense variant moderate contig83 1803058

IGV: Start, Jump

G/A
NGS:
0.000
C90:
0.000
FAD2-2

UniProt

c.303G>T p.Trp101Cys missense variant moderate contig83 1803066

IGV: Start, Jump

C/A
NGS:
0.000
C90:
0.000
FAD2-2

UniProt

c.248C>G p.Pro83Arg missense variant moderate contig83 1803121

IGV: Start, Jump

G/C
NGS:
0.004
C90:
0.000
FAD2-2

UniProt

c.208C>T p.Pro70Ser missense variant moderate contig83 1803161

IGV: Start, Jump

G/A
NGS:
0.000
C90:
0.000
FAD2-2

UniProt

c.190C>T p.His64Tyr missense variant moderate contig83 1803179

IGV: Start, Jump

G/A
NGS:
0.013
C90:
0.000
FAD2-2

UniProt

c.161T>A p.Leu54His missense variant moderate contig83 1803208

IGV: Start, Jump

A/T
NGS:
0.156
C90:
0.000
FAD2-2

UniProt

c.154G>T p.Val52Phe missense variant moderate contig83 1803215

IGV: Start, Jump

C/A
NGS:
0.002
C90:
0.000
FAD2-2

UniProt

c.5A>C p.Gln2Pro missense variant moderate contig83 1803364

IGV: Start, Jump

T/G
NGS:
0.007
C90:
0.000
ELF4

UniProt

c.395C>T p.Pro132Leu missense variant moderate contig869 622175

IGV: Start, Jump

G/A
NGS:
0.000
C90:
0.000
ELF3

UniProt

c.574A>G p.Asn192Asp missense variant moderate contig97 242280

IGV: Start, Jump

A/G
NGS:
0.042
C90:
0.579
ELF3

UniProt

c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump

A/G
NGS:
0.112
C90:
0.000
ELF3

UniProt

c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump

G/C
NGS:
0.114
C90:
0.938
ELF5

UniProt

c.1505C>T p.Ala502Val missense variant moderate contig382 881943

IGV: Start, Jump

C/T
NGS:
0.000
C90:
0.000
aPT1

UniProt

c.160A>C p.Thr54Pro missense variant moderate contig121 2835867

IGV: Start, Jump

A/C
NGS:
0.086
C90:
0.048
aPT1

UniProt

c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump

A/G
NGS:
0.579
C90:
0.761
aPT1

UniProt

c.629C>T p.Thr210Ile missense variant moderate contig121 2840237

IGV: Start, Jump

C/T
NGS:
0.561
C90:
0.598
aPT1

UniProt

c.670T>A p.Ser224Thr missense variant moderate contig121 2840278

IGV: Start, Jump

T/A
NGS:
0.077
C90:
0.000
aPT1

UniProt

c.727G>T p.Glu243* stop gained high contig121 2841362

IGV: Start, Jump

G/T
NGS:
0.127
C90:
0.100
AAE1-2

UniProt

c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump

A/G
NGS:
0.123
C90:
0.000
AAE1-2

UniProt

c.374A>G p.His125Arg missense variant moderate contig81 209336

IGV: Start, Jump

A/G
NGS:
0.026
C90:
0.000
AAE1-2

UniProt

c.948_949insA p.Asp317fs frameshift variant high contig81 209910

IGV: Start, Jump

C/CA
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.952delC p.Gln318fs frameshift variant high contig81 209912

IGV: Start, Jump

AC/A
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.953A>G p.Gln318Arg missense variant moderate contig81 209915

IGV: Start, Jump

A/G
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.955C>T p.Arg319Cys missense variant moderate contig81 209917

IGV: Start, Jump

C/T
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump

A/G
NGS:
0.116
C90:
0.000
AAE1-2

UniProt

c.1102C>A p.His368Asn missense variant moderate contig81 210064

IGV: Start, Jump

C/A
NGS:
0.033
C90:
0.000
AAE1-2

UniProt

c.1115A>G p.Glu372Gly missense variant moderate contig81 210077

IGV: Start, Jump

A/G
NGS:
0.004
C90:
0.000
AAE1-2

UniProt

c.1415G>A p.Ser472Asn missense variant moderate contig81 210377

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1417A>G p.Thr473Ala missense variant moderate contig81 210379

IGV: Start, Jump

A/G
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1434G>T p.Glu478Asp missense variant moderate contig81 210396

IGV: Start, Jump

G/T
NGS:
0.075
C90:
0.000
PHL-1

UniProt

c.3022_3027dupCAGCAG p.Gln1008_Gln1009dup conservative inframe insertion moderate contig1439 1486769

IGV: Start, Jump

T/TCTGCTG
NGS:
0.000
C90:
0.000
PHL-1

UniProt

c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump

T/C
NGS:
0.123
C90:
0.000
PHL-1

UniProt

c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump

T/C
NGS:
0.116
C90:
0.890
PHL-1

UniProt

c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump

T/C
NGS:
0.107
C90:
0.904
Edestin

UniProt

c.16T>C p.Ser6Pro missense variant moderate contig850 3065274

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.000
PKSG-2b

UniProt

c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump

A/T
NGS:
0.715
C90:
0.895
PKSG-2b

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump

G/C
NGS:
0.717
C90:
0.000
PKSG-2b

UniProt

c.948T>G p.Asp316Glu missense variant moderate contig700 1950690

IGV: Start, Jump

A/C
NGS:
0.456
C90:
0.000
PKSG-2b

UniProt

c.945T>G p.Ser315Arg missense variant moderate contig700 1950693

IGV: Start, Jump

A/C
NGS:
0.454
C90:
0.000
PKSG-2b

UniProt

c.944G>A p.Ser315Asn missense variant moderate contig700 1950694

IGV: Start, Jump

C/T
NGS:
0.445
C90:
0.000
PKSG-2b

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1950704

IGV: Start, Jump

G/C
NGS:
0.410
C90:
0.000
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-2b

UniProt

c.-2_1dupATA start lost & conservative inframe insertion high contig700 1951880

IGV: Start, Jump

A/ATAT
NGS:
0.410
C90:
0.000
TFL1

UniProt

c.302-1G>A splice acceptor variant & intron variant high contig1636 520616

IGV: Start, Jump

C/T
NGS:
0.103
C90:
0.794
FAD4

UniProt

c.179A>G p.Lys60Arg missense variant moderate contig784 1690931

IGV: Start, Jump

A/G
NGS:
0.000
C90:
0.000
HDS-1

UniProt

c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump

T/C
NGS:
0.099
C90:
0.861
HDS-1

UniProt

c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump

C/T
NGS:
0.167
C90:
0.000
HDS-1

UniProt

c.109G>A p.Val37Ile missense variant moderate contig1891 889283

IGV: Start, Jump

C/T
NGS:
0.002
C90:
0.000
HDS-1

UniProt

c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump

G/C
NGS:
0.125
C90:
0.943
HDS-1

UniProt

c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump

A/AC
NGS:
0.217
C90:
0.000
PIE1-2

UniProt

c.6653A>G p.Asn2218Ser missense variant moderate contig1460 1184434

IGV: Start, Jump

T/C
NGS:
0.059
C90:
0.928
PIE1-2

UniProt

c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump

T/C
NGS:
0.061
C90:
0.268
PIE1-2

UniProt

c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump

A/T
NGS:
0.086
C90:
0.990
PIE1-2

UniProt

c.1630G>C p.Ala544Pro missense variant moderate contig1460 1191600

IGV: Start, Jump

C/G
NGS:
0.070
C90:
0.933
PIE1-2

UniProt

c.1289A>G p.Asp430Gly missense variant moderate contig1460 1192109

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
PIE1-2

UniProt

c.1243G>C p.Asp415His missense variant moderate contig1460 1192155

IGV: Start, Jump

C/G
NGS:
0.002
C90:
0.000
PIE1-2

UniProt

c.710C>T p.Pro237Leu missense variant moderate contig1460 1193804

IGV: Start, Jump

G/A
NGS:
0.072
C90:
0.866
PIE1-2

UniProt

c.706T>C p.Tyr236His missense variant moderate contig1460 1193808

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.737
PIE1-2

UniProt

c.665+2T>A splice donor variant & intron variant high contig1460 1194391

IGV: Start, Jump

A/T
NGS:
0.009
C90:
0.000
PIE1-2

UniProt

c.637T>A p.Ser213Thr missense variant moderate contig1460 1194421

IGV: Start, Jump

A/T
NGS:
0.079
C90:
0.885
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
FT

UniProt

c.13C>G p.Leu5Val missense variant moderate contig1561 3124437

IGV: Start, Jump

C/G
NGS:
0.031
C90:
0.153
FT

UniProt

c.38_43delATAATA p.Asn13_Asn14del disruptive inframe deletion moderate contig1561 3124441

IGV: Start, Jump

TTAATAA/T
NGS:
0.000
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.517A>T p.Ile173Leu missense variant & splice region variant moderate contig121 2830795

IGV: Start, Jump

A/T
NGS:
0.022
C90:
0.000
aPT4

UniProt

c.634C>A p.Pro212Thr missense variant moderate contig121 2830912

IGV: Start, Jump

C/A
NGS:
0.009
C90:
0.000
aPT4

UniProt

c.757G>T p.Val253Leu missense variant moderate contig121 2831364

IGV: Start, Jump

G/T
NGS:
0.039
C90:
0.000
aPT4

UniProt

c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump

T/C
NGS:
0.546
C90:
0.000
AAE1-3

UniProt

c.722G>A p.Arg241Lys missense variant moderate contig976 1083132

IGV: Start, Jump

C/T
NGS:
0.070
C90:
0.000
AAE1-3

UniProt

c.659G>A p.Arg220Gln missense variant moderate contig976 1083195

IGV: Start, Jump

C/T
NGS:
0.077
C90:
0.000
AAE1-3

UniProt

c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump

C/G
NGS:
0.116
C90:
0.000
AAE1-3

UniProt

c.484G>A p.Val162Ile missense variant moderate contig976 1083541

IGV: Start, Jump

C/T
NGS:
0.000
C90:
0.000
AAE1-3

UniProt

c.199A>G p.Asn67Asp missense variant moderate contig976 1083876

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
AAE1-3

UniProt

c.188A>G p.Asn63Ser missense variant moderate contig976 1083887

IGV: Start, Jump

T/C
NGS:
0.077
C90:
0.000
PIE1-1

UniProt

c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump

C/G
NGS:
0.096
C90:
0.852
GGR

UniProt

c.376G>C p.Glu126Gln missense variant moderate contig2282 549368

IGV: Start, Jump

G/C
NGS:
0.015
C90:
0.110
GGR

UniProt

c.382C>T p.Leu128Phe missense variant moderate contig2282 549374

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.000
GGR

UniProt

c.456T>A p.His152Gln missense variant moderate contig2282 549448

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
GGR

UniProt

c.460G>A p.Asp154Asn missense variant moderate contig2282 549452

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
GGR

UniProt

c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump

A/T
NGS:
0.121
C90:
0.000
PKSB-3

UniProt

c.64A>C p.Ser22Arg missense variant moderate contig93 3333355

IGV: Start, Jump

A/C
NGS:
0.000
C90:
0.000
PKSB-3

UniProt

c.181G>A p.Val61Ile missense variant moderate contig93 3333938

IGV: Start, Jump

G/A
NGS:
0.000
C90:
0.000
PKSB-3

UniProt

c.274T>G p.Ser92Ala missense variant moderate contig93 3335429

IGV: Start, Jump

T/G
NGS:
0.000
C90:
0.000
PKSB-3

UniProt

c.1652A>G p.Glu551Gly missense variant moderate contig93 3339759

IGV: Start, Jump

A/G
NGS:
0.088
C90:
0.000
PKSB-3

UniProt

c.1874C>A p.Ser625Tyr missense variant moderate contig93 3339981

IGV: Start, Jump

C/A
NGS:
0.000
C90:
0.000
FAD2

UniProt

c.94A>G p.Thr32Ala missense variant moderate contig1460 1084166

IGV: Start, Jump

T/C
NGS:
0.015
C90:
0.000

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4448655
Overlapping SNPs:
12
Concordance:
10

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495181
Overlapping SNPs:
4
Concordance:
4
QR code for SRR14708198

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings