SCN

SRR 14708201

Grower: Lanzhou University, Guangpeng Ren

General Information

Accession Date
May 31, 2021
Reported Plant Sex
unknown

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Uncommon
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.49%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0198
male female SRR14708201

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

No variants to report

Variants (Select Genes of Interest)

EMF1-2

UniProt

c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

A/C
NGS:
0.090
C90:
0.474
PHL-2 c.411C>A p.Phe137Leu missense variant moderate contig2621 339062

IGV: Start, Jump

C/A
NGS:
0.000
C90:
0.000
PHL-2 c.455A>C p.Asp152Ala missense variant moderate contig2621 339191

IGV: Start, Jump

A/C
NGS:
0.018
C90:
0.507
PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

T/A
NGS:
0.064
C90:
0.732
PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.746
PHL-2 c.2756A>C p.Glu919Ala missense variant moderate contig2621 342799

IGV: Start, Jump

A/C
NGS:
0.064
C90:
0.675
PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

G/A
NGS:
0.107
C90:
0.890
PHL-2 c.2830A>G p.Asn944Asp missense variant moderate contig2621 342873

IGV: Start, Jump

A/G
NGS:
0.018
C90:
0.000
PHL-2 c.2903_2905dupGCA p.Ser968dup disruptive inframe insertion moderate contig2621 342939

IGV: Start, Jump

T/TGCA
NGS:
0.018
C90:
0.522
PHL-2 c.3062A>T p.His1021Leu missense variant moderate contig2621 343105

IGV: Start, Jump

A/T
NGS:
0.000
C90:
0.000
PHL-2 c.3209A>G p.Gln1070Arg missense variant moderate contig2621 343252

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.885
PHL-2 c.3467A>G p.Gln1156Arg missense variant moderate contig2621 343510

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.713
PHL-2 c.3552delG p.Lys1185fs frameshift variant high contig2621 343593

IGV: Start, Jump

CG/C
NGS:
0.004
C90:
0.000
PKSG-4b

UniProt

c.544G>T p.Gly182Trp missense variant moderate contig700 2721129

IGV: Start, Jump

C/A
NGS:
0.055
C90:
0.000
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.419A>G p.Asp140Gly missense variant moderate contig700 2721254

IGV: Start, Jump

T/C
NGS:
0.430
C90:
0.440
PKSG-4b

UniProt

c.316+2T>A splice donor variant & intron variant high contig700 2723818

IGV: Start, Jump

A/T
NGS:
0.070
C90:
0.689
PKSG-4b

UniProt

c.229G>A p.Gly77Ser missense variant moderate contig700 2724206

IGV: Start, Jump

C/T
NGS:
0.042
C90:
0.000
PKSG-4b

UniProt

c.216G>C p.Leu72Phe missense variant moderate contig700 2724219

IGV: Start, Jump

C/G
NGS:
0.044
C90:
0.000
PKSG-4b

UniProt

c.206T>C p.Leu69Ser missense variant moderate contig700 2724229

IGV: Start, Jump

A/G
NGS:
0.044
C90:
0.000
PKSG-4a

UniProt

c.587_588insTGTTAGATAATGCTTAGCTGTCACTGTTAGTTACATGTTTCTGTTATATTTGTTATTCTGTTGGTTCAGTTGTACATTCTGTTACTCTTGTTTTCTCTGTATATAAGTTGTACTCGATCACCATTATTGGTCATTCAATAAAGATTCATTTTCTTCAATTCTCTATTCTCTCTAACAATGAT p.Met196fs frameshift variant & stop gained high contig700 1937993

IGV: Start, Jump

C/CATGATTGTTAGATAATGCTTAGCTGTCACTGTTAGTTACATGTTTCTGTTATATTTGTTATTCTGTTGGTTCAGTTGTACATTCTGTTACTCTTGTTTTCTCTGTATATAAGTTGTACTCGATCACCATTATTGGTCATTCAATAAAGATTCATTTTCTTCAATTCTCTATTCTCTCTAACA
NGS:
0.000
C90:
0.000
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2a

UniProt

c.948T>G p.Asp316Glu missense variant moderate contig700 1944442

IGV: Start, Jump

A/C
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.945T>G p.Ser315Arg missense variant moderate contig700 1944445

IGV: Start, Jump

A/C
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.944G>A p.Ser315Asn missense variant moderate contig700 1944446

IGV: Start, Jump

C/T
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1944456

IGV: Start, Jump

G/C
NGS:
0.070
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
FAD2-2

UniProt

c.190C>T p.His64Tyr missense variant moderate contig83 1803179

IGV: Start, Jump

G/A
NGS:
0.013
C90:
0.000
FAD2-2

UniProt

c.62C>T p.Pro21Leu missense variant moderate contig83 1803307

IGV: Start, Jump

G/A
NGS:
0.042
C90:
0.000
FAD2-2

UniProt

c.23G>A p.Ser8Asn missense variant moderate contig83 1803346

IGV: Start, Jump

C/T
NGS:
0.009
C90:
0.000
FAD2-2

UniProt

c.5A>C p.Gln2Pro missense variant moderate contig83 1803364

IGV: Start, Jump

T/G
NGS:
0.007
C90:
0.000
ELF4

UniProt

c.144T>A p.Asp48Glu missense variant moderate contig869 622426

IGV: Start, Jump

A/T
NGS:
0.031
C90:
0.000
ELF3

UniProt

c.358G>A p.Gly120Arg missense variant moderate contig97 242064

IGV: Start, Jump

G/A
NGS:
0.099
C90:
0.493
ELF3

UniProt

c.520A>C p.Asn174His missense variant moderate contig97 242226

IGV: Start, Jump

A/C
NGS:
0.094
C90:
0.502
ELF3

UniProt

c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump

A/G
NGS:
0.112
C90:
0.000
ELF3

UniProt

c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump

G/C
NGS:
0.114
C90:
0.938
ELF3

UniProt

c.1771G>A p.Ala591Thr missense variant moderate contig97 244602

IGV: Start, Jump

G/A
NGS:
0.000
C90:
0.000
ELF3

UniProt

c.1803_1805delTCA p.His601del disruptive inframe deletion moderate contig97 244625

IGV: Start, Jump

ACAT/A
NGS:
0.092
C90:
0.000
ELF3

UniProt

c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump

C/G
NGS:
0.123
C90:
0.632
ELF3

UniProt

c.2140C>T p.Pro714Ser missense variant moderate contig97 244971

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.038
ELF3

UniProt

c.2141C>G p.Pro714Arg missense variant moderate contig97 244972

IGV: Start, Jump

C/G
NGS:
0.088
C90:
0.335
ELF3

UniProt

c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump

G/T
NGS:
0.125
C90:
0.531
ELF5

UniProt

c.853C>T p.Pro285Ser missense variant moderate contig382 880715

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.153
aPT1

UniProt

c.2_6dupTGGGA p.Leu3fs frameshift variant high contig121 2835707

IGV: Start, Jump

C/CATGGG
NGS:
0.000
C90:
0.000
aPT1

UniProt

c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump

A/G
NGS:
0.579
C90:
0.761
AAE1-2

UniProt

c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump

A/G
NGS:
0.116
C90:
0.000
AAE1-2

UniProt

c.1090A>G p.Lys364Glu missense variant moderate contig81 210052

IGV: Start, Jump

A/G
NGS:
0.007
C90:
0.000
AAE1-2

UniProt

c.1102C>A p.His368Asn missense variant moderate contig81 210064

IGV: Start, Jump

C/A
NGS:
0.033
C90:
0.000
AAE1-2

UniProt

c.1118C>G p.Thr373Ser missense variant moderate contig81 210080

IGV: Start, Jump

C/G
NGS:
0.026
C90:
0.000
AAE1-2

UniProt

c.1327_1328insGTA p.Glu442_Thr443insSer disruptive inframe insertion moderate contig81 210288

IGV: Start, Jump

A/AAGT
NGS:
0.000
C90:
0.000
AAE1-2

UniProt

c.1406A>G p.Asn469Ser missense variant moderate contig81 210368

IGV: Start, Jump

A/G
NGS:
0.000
C90:
0.000
AAE1-2

UniProt

c.1415G>A p.Ser472Asn missense variant moderate contig81 210377

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1417A>G p.Thr473Ala missense variant moderate contig81 210379

IGV: Start, Jump

A/G
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1434G>T p.Glu478Asp missense variant moderate contig81 210396

IGV: Start, Jump

G/T
NGS:
0.075
C90:
0.000
AAE1-2

UniProt

c.1541T>C p.Val514Ala missense variant moderate contig81 210503

IGV: Start, Jump

T/C
NGS:
0.050
C90:
0.000
PHL-1

UniProt

c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump

T/C
NGS:
0.123
C90:
0.000
PHL-1

UniProt

c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump

T/C
NGS:
0.116
C90:
0.890
PHL-1

UniProt

c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump

T/C
NGS:
0.107
C90:
0.904
PHL-1

UniProt

c.1306G>A p.Gly436Ser missense variant moderate contig1439 1489892

IGV: Start, Jump

C/T
NGS:
0.000
C90:
0.000
PHL-1

UniProt

c.407G>A p.Arg136Gln missense variant moderate contig1439 1491441

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.139
PHL-1

UniProt

c.176G>A p.Gly59Glu missense variant moderate contig1439 1492817

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.000
PHL-1

UniProt

c.175G>A p.Gly59Arg missense variant moderate contig1439 1492818

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.144
Edestin

UniProt

c.130_131insATT p.Gly43_Ser44insTyr conservative inframe insertion moderate contig850 3065159

IGV: Start, Jump

G/GAAT
NGS:
0.009
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
TFL1

UniProt

c.302-1G>A splice acceptor variant & intron variant high contig1636 520616

IGV: Start, Jump

C/T
NGS:
0.103
C90:
0.794
HDS-1

UniProt

c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump

T/C
NGS:
0.099
C90:
0.861
HDS-1

UniProt

c.1579T>C p.Tyr527His missense variant moderate contig1891 885975

IGV: Start, Jump

A/G
NGS:
0.002
C90:
0.000
HDS-1

UniProt

c.1558T>C p.Ser520Pro missense variant moderate contig1891 885996

IGV: Start, Jump

A/G
NGS:
0.000
C90:
0.000
HDS-1

UniProt

c.136G>A p.Val46Ile missense variant moderate contig1891 889256

IGV: Start, Jump

C/T
NGS:
0.088
C90:
0.593
HDS-1

UniProt

c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump

G/C
NGS:
0.125
C90:
0.943
HDS-1

UniProt

c.51C>G p.Asp17Glu missense variant moderate contig1891 889341

IGV: Start, Jump

G/C
NGS:
0.000
C90:
0.000
HDS-1

UniProt

c.35G>A p.Cys12Tyr missense variant moderate contig1891 889357

IGV: Start, Jump

C/T
NGS:
0.094
C90:
0.646
HDS-1

UniProt

c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump

A/AC
NGS:
0.217
C90:
0.000
PIE1-2

UniProt

c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump

T/C
NGS:
0.061
C90:
0.268
PIE1-2

UniProt

c.1630G>C p.Ala544Pro missense variant moderate contig1460 1191600

IGV: Start, Jump

C/G
NGS:
0.070
C90:
0.933
PIE1-2

UniProt

c.1289A>G p.Asp430Gly missense variant moderate contig1460 1192109

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
EMF2

UniProt

c.722C>T p.Thr241Ile missense variant moderate contig954 3050302

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.062
EMF2

UniProt

c.1205C>T p.Ala402Val missense variant & splice region variant moderate contig954 3055694

IGV: Start, Jump

C/T
NGS:
0.015
C90:
0.053
EMF2

UniProt

c.1228A>G p.Ser410Gly missense variant moderate contig954 3055717

IGV: Start, Jump

A/G
NGS:
0.015
C90:
0.000
EMF2

UniProt

c.1315G>C p.Ala439Pro missense variant moderate contig954 3055804

IGV: Start, Jump

G/C
NGS:
0.015
C90:
0.053
EMF2

UniProt

c.1742C>G p.Thr581Ser missense variant moderate contig954 3059899

IGV: Start, Jump

C/G
NGS:
0.011
C90:
0.000
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
EMF1-1

UniProt

c.193A>G p.Ile65Val missense variant moderate contig883 269682

IGV: Start, Jump

A/G
NGS:
0.000
C90:
0.000
FT

UniProt

c.240C>G p.Asn80Lys missense variant moderate contig1561 3124664

IGV: Start, Jump

C/G
NGS:
0.075
C90:
0.000
FT

UniProt

c.395_396insTTA p.Gln132delinsHisTer stop gained & disruptive inframe insertion high contig1561 3126431

IGV: Start, Jump

C/CATT
NGS:
0.000
C90:
0.000
aPT4

UniProt

c.153A>T p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/T
NGS:
0.000
C90:
0.000
AAE1-3

UniProt

c.729G>T p.Lys243Asn missense variant moderate contig976 1083125

IGV: Start, Jump

C/A
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump

C/G
NGS:
0.116
C90:
0.000
AAE1-3

UniProt

c.487A>T p.Met163Leu missense variant moderate contig976 1083538

IGV: Start, Jump

T/A
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.467T>C p.Met156Thr missense variant moderate contig976 1083558

IGV: Start, Jump

A/G
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.416T>C p.Leu139Pro missense variant moderate contig976 1083609

IGV: Start, Jump

A/G
NGS:
0.061
C90:
0.000
AAE1-3

UniProt

c.388G>A p.Gly130Ser missense variant moderate contig976 1083637

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.382T>C p.Tyr128His missense variant moderate contig976 1083643

IGV: Start, Jump

A/G
NGS:
0.072
C90:
0.000
AAE1-3

UniProt

c.327G>T p.Trp109Cys missense variant moderate contig976 1083698

IGV: Start, Jump

C/A
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.301A>T p.Thr101Ser missense variant moderate contig976 1083724

IGV: Start, Jump

T/A
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.293A>G p.Asp98Gly missense variant moderate contig976 1083732

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.235A>C p.Lys79Gln missense variant & splice region variant moderate contig976 1083840

IGV: Start, Jump

T/G
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.167A>G p.Glu56Gly missense variant moderate contig976 1083908

IGV: Start, Jump

T/C
NGS:
0.070
C90:
0.000
AAE1-3

UniProt

c.147G>T p.Gln49His missense variant moderate contig976 1083928

IGV: Start, Jump

C/A
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.127A>G p.Ile43Val missense variant moderate contig976 1083948

IGV: Start, Jump

T/C
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.125A>G p.Glu42Gly missense variant moderate contig976 1083950

IGV: Start, Jump

T/C
NGS:
0.064
C90:
0.000
AAE1-3

UniProt

c.80C>T p.Thr27Ile missense variant moderate contig976 1083995

IGV: Start, Jump

G/A
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.79A>G p.Thr27Ala missense variant moderate contig976 1083996

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.52G>A p.Gly18Ser missense variant moderate contig976 1084023

IGV: Start, Jump

C/T
NGS:
0.064
C90:
0.000
AAE1-3

UniProt

c.48C>A p.Cys16* stop gained high contig976 1084027

IGV: Start, Jump

G/T
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.14C>T p.Ala5Val missense variant moderate contig976 1084061

IGV: Start, Jump

G/A
NGS:
0.004
C90:
0.000
PIE1-1

UniProt

c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump

C/G
NGS:
0.096
C90:
0.852
GGR

UniProt

c.456T>A p.His152Gln missense variant moderate contig2282 549448

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
GGR

UniProt

c.460G>A p.Asp154Asn missense variant moderate contig2282 549452

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
GGR

UniProt

c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump

A/T
NGS:
0.121
C90:
0.000
PKSB-3

UniProt

c.1652A>G p.Glu551Gly missense variant moderate contig93 3339759

IGV: Start, Jump

A/G
NGS:
0.088
C90:
0.000
PKSB-3

UniProt

c.1946C>T p.Pro649Leu missense variant moderate contig93 3340053

IGV: Start, Jump

C/T
NGS:
0.009
C90:
0.000

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4448583
Overlapping SNPs:
16
Concordance:
13

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495237
Overlapping SNPs:
5
Concordance:
5
QR code for SRR14708201

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings