IMA

SRR 14708203

Grower: Lanzhou University, Guangpeng Ren

General Information

Accession Date
May 31, 2021
Reported Plant Sex
unknown

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type II

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.76%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0201
male female SRR14708203

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

THCAS c.1458C>G p.Asp486Glu missense variant moderate contig741 4416370

IGV: Start, Jump

G/C
NGS:
0.000
C90:
0.000
THCAS c.373G>C p.Val125Leu missense variant moderate contig741 4417455

IGV: Start, Jump

C/G
NGS:
0.050
C90:
0.000

Variants (Select Genes of Interest)

GPPs1

UniProt

c.160A>G p.Lys54Glu missense variant moderate contig676 168409

IGV: Start, Jump

A/G
NGS:
0.026
C90:
0.000
GPPs1

UniProt

c.472T>A p.Leu158Met missense variant moderate contig676 168721

IGV: Start, Jump

T/A
NGS:
0.020
C90:
0.000
GPPs1

UniProt

c.744C>G p.Asp248Glu missense variant moderate contig676 168993

IGV: Start, Jump

C/G
NGS:
0.022
C90:
0.000
GPPs1

UniProt

c.807_814delGCATTTTT p.His270fs frameshift variant high contig676 169595

IGV: Start, Jump

GTGCATTTT/G
NGS:
0.015
C90:
0.000
GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
GPPs1

UniProt

c.855_862delGGCGAAAG p.Trp285fs frameshift variant high contig676 169643

IGV: Start, Jump

TGGGCGAAA/T
NGS:
0.000
C90:
0.000
GPPs1

UniProt

c.857_864delCGAAAGAG p.Ala286fs frameshift variant high contig676 169645

IGV: Start, Jump

GGCGAAAGA/G
NGS:
0.009
C90:
0.000
GPPs1

UniProt

c.863A>T p.Glu288Val missense variant moderate contig676 169653

IGV: Start, Jump

A/T
NGS:
0.000
C90:
0.000
GPPs1

UniProt

c.866_877delTACTAGAGCTAG p.Leu289_Glu293delinsTer stop gained & disruptive inframe deletion high contig676 169655

IGV: Start, Jump

TTACTAGAGCTAG/T
NGS:
0.009
C90:
0.000
GPPs1

UniProt

c.896A>G p.Asn299Ser missense variant moderate contig676 169772

IGV: Start, Jump

A/G
NGS:
0.046
C90:
0.000
GPPs1

UniProt

c.923_927+5delTTTTGGTACT p.Val308fs frameshift variant & splice donor variant & splice region variant & intron variant high contig676 169798

IGV: Start, Jump

GTTTTGGTACT/G
NGS:
0.009
C90:
0.000
EMF1-2

UniProt

c.446C>T p.Ala149Val missense variant moderate contig885 546

IGV: Start, Jump

C/T
NGS:
0.000
C90:
0.000
EMF1-2

UniProt

c.634G>C p.Val212Leu missense variant moderate contig885 734

IGV: Start, Jump

G/C
NGS:
0.015
C90:
0.239
EMF1-2

UniProt

c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

A/C
NGS:
0.090
C90:
0.474
EMF1-2

UniProt

c.1187T>C p.Leu396Ser missense variant moderate contig885 2073

IGV: Start, Jump

T/C
NGS:
0.026
C90:
0.000
EMF1-2

UniProt

c.1189G>A p.Ala397Thr missense variant moderate contig885 2075

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1376G>T p.Gly459Val missense variant moderate contig885 2262

IGV: Start, Jump

G/T
NGS:
0.000
C90:
0.000
EMF1-2

UniProt

c.1384A>C p.Lys462Gln missense variant moderate contig885 2270

IGV: Start, Jump

A/C
NGS:
0.013
C90:
0.254
EMF1-2

UniProt

c.1409G>A p.Arg470Lys missense variant moderate contig885 2295

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1828A>G p.Ile610Val missense variant moderate contig885 2714

IGV: Start, Jump

A/G
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.2256A>T p.Lys752Asn missense variant moderate contig885 3142

IGV: Start, Jump

A/T
NGS:
0.026
C90:
0.000
EMF1-2

UniProt

c.2653A>G p.Thr885Ala missense variant moderate contig885 3539

IGV: Start, Jump

A/G
NGS:
0.007
C90:
0.000
PHL-2 c.455A>C p.Asp152Ala missense variant moderate contig2621 339191

IGV: Start, Jump

A/C
NGS:
0.018
C90:
0.507
PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

T/A
NGS:
0.064
C90:
0.732
PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.746
PHL-2 c.2756A>C p.Glu919Ala missense variant moderate contig2621 342799

IGV: Start, Jump

A/C
NGS:
0.064
C90:
0.675
PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

G/A
NGS:
0.107
C90:
0.890
PHL-2 c.2830A>G p.Asn944Asp missense variant moderate contig2621 342873

IGV: Start, Jump

A/G
NGS:
0.018
C90:
0.000
PHL-2 c.2903_2905dupGCA p.Ser968dup disruptive inframe insertion moderate contig2621 342939

IGV: Start, Jump

T/TGCA
NGS:
0.018
C90:
0.522
PHL-2 c.3379C>G p.His1127Asp missense variant moderate contig2621 343422

IGV: Start, Jump

C/G
NGS:
0.004
C90:
0.000
PHL-2 c.3380A>G p.His1127Arg missense variant moderate contig2621 343423

IGV: Start, Jump

A/G
NGS:
0.004
C90:
0.000
PHL-2 c.3381T>A p.His1127Gln missense variant moderate contig2621 343424

IGV: Start, Jump

T/A
NGS:
0.004
C90:
0.000
PHL-2 c.3467A>G p.Gln1156Arg missense variant moderate contig2621 343510

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.713
PHL-2 c.3552delG p.Lys1185fs frameshift variant high contig2621 343593

IGV: Start, Jump

CG/C
NGS:
0.004
C90:
0.000
PKSG-4b

UniProt

c.473_504delTTGTAATGGACAAGTTTGAGGAAAAGGTCATT p.Phe158fs frameshift variant high contig700 2721168

IGV: Start, Jump

CAATGACCTTTTCCTCAAACTTGTCCATTACAA/C
NGS:
0.000
C90:
0.000
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.419A>G p.Asp140Gly missense variant moderate contig700 2721254

IGV: Start, Jump

T/C
NGS:
0.430
C90:
0.440
PKSG-4b

UniProt

c.413T>C p.Met138Thr missense variant moderate contig700 2721260

IGV: Start, Jump

A/G
NGS:
0.002
C90:
0.000
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.353_354insCC p.Gly119fs frameshift variant high contig700 2721319

IGV: Start, Jump

T/TGG
NGS:
0.175
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
AAE1-1

UniProt

c.1580A>G p.Asn527Ser missense variant moderate contig606 3242691

IGV: Start, Jump

T/C
NGS:
0.004
C90:
0.000
AAE1-1

UniProt

c.1204C>G p.Pro402Ala missense variant moderate contig606 3243067

IGV: Start, Jump

G/C
NGS:
0.000
C90:
0.000
AAE1-1

UniProt

c.1010C>T p.Pro337Leu missense variant moderate contig606 3243261

IGV: Start, Jump

G/A
NGS:
0.000
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
OAC-2

UniProt

c.260C>G p.Ser87Cys missense variant moderate contig931 109979

IGV: Start, Jump

G/C
NGS:
0.070
C90:
0.000
FAD2-2

UniProt

c.309G>C p.Glu103Asp missense variant moderate contig83 1803060

IGV: Start, Jump

C/G
NGS:
0.000
C90:
0.000
FAD2-2

UniProt

c.216C>A p.Tyr72* stop gained high contig83 1803153

IGV: Start, Jump

G/T
NGS:
0.000
C90:
0.000
FAD2-2

UniProt

c.190C>T p.His64Tyr missense variant moderate contig83 1803179

IGV: Start, Jump

G/A
NGS:
0.013
C90:
0.000
FAD2-2

UniProt

c.161T>A p.Leu54His missense variant moderate contig83 1803208

IGV: Start, Jump

A/T
NGS:
0.156
C90:
0.000
FAD2-2

UniProt

c.86C>T p.Ser29Phe missense variant moderate contig83 1803283

IGV: Start, Jump

G/A
NGS:
0.000
C90:
0.000
ELF4

UniProt

c.410A>G p.His137Arg missense variant moderate contig869 622160

IGV: Start, Jump

T/C
NGS:
0.000
C90:
0.000
ELF3

UniProt

c.574A>G p.Asn192Asp missense variant moderate contig97 242280

IGV: Start, Jump

A/G
NGS:
0.042
C90:
0.579
ELF3

UniProt

c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump

A/G
NGS:
0.112
C90:
0.000
ELF3

UniProt

c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump

G/C
NGS:
0.114
C90:
0.938
ELF3

UniProt

c.1366T>G p.Leu456Val missense variant moderate contig97 244197

IGV: Start, Jump

T/G
NGS:
0.015
C90:
0.000
ELF3

UniProt

c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump

G/A
NGS:
0.123
C90:
0.000
ELF3

UniProt

c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.545
ELF3

UniProt

c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump

C/G
NGS:
0.123
C90:
0.632
ELF3

UniProt

c.2142_2144delTCC p.Pro715del disruptive inframe deletion moderate contig97 244965

IGV: Start, Jump

GCTC/G
NGS:
0.002
C90:
0.000
ELF3

UniProt

c.2198delG p.Arg733fs frameshift variant high contig97 245028

IGV: Start, Jump

CG/C
NGS:
0.002
C90:
0.612
ELF3

UniProt

c.2200_2204delCATCA p.His734fs frameshift variant high contig97 245030

IGV: Start, Jump

TCATCA/T
NGS:
0.002
C90:
0.000
aPT1

UniProt

c.310_311insTGTTAAGACAACTAATAGTGTT p.Trp104fs frameshift variant high contig121 2836197

IGV: Start, Jump

A/ATGTTTGTTAAGACAACTAATAG
NGS:
0.000
C90:
0.000
aPT1

UniProt

c.312_313insTTAAAAGCAGTTAGTTTGTTAGTTTGTTACAAGCTGTTGTAATCTGTTAGTTGTTGTT p.Lys105fs frameshift variant & stop gained high contig121 2836203

IGV: Start, Jump

G/GTTAAAAGCAGTTAGTTTGTTAGTTTGTTACAAGCTGTTGTAATCTGTTAGTTGTTGTT
NGS:
0.000
C90:
0.000
aPT1

UniProt

c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump

A/G
NGS:
0.579
C90:
0.761
aPT1

UniProt

c.574A>T p.Met192Leu missense variant moderate contig121 2840182

IGV: Start, Jump

A/T
NGS:
0.024
C90:
0.000
aPT1

UniProt

c.595A>G p.Ile199Val missense variant moderate contig121 2840203

IGV: Start, Jump

A/G
NGS:
0.000
C90:
0.000
aPT1

UniProt

c.629C>T p.Thr210Ile missense variant moderate contig121 2840237

IGV: Start, Jump

C/T
NGS:
0.561
C90:
0.598
aPT1

UniProt

c.727G>T p.Glu243* stop gained high contig121 2841362

IGV: Start, Jump

G/T
NGS:
0.127
C90:
0.100
aPT1

UniProt

c.766T>C p.Tyr256His missense variant moderate contig121 2841545

IGV: Start, Jump

T/C
NGS:
0.002
C90:
0.000
OAC-1

UniProt

c.260C>G p.Ser87Cys missense variant moderate contig931 118104

IGV: Start, Jump

G/C
NGS:
0.053
C90:
0.000
OAC-1

UniProt

c.220A>G p.Ile74Val missense variant moderate contig931 118144

IGV: Start, Jump

T/C
NGS:
0.033
C90:
0.670
OAC-1

UniProt

c.185C>T p.Thr62Ile missense variant moderate contig931 118179

IGV: Start, Jump

G/A
NGS:
0.039
C90:
0.000
OAC-1

UniProt

c.175G>A p.Val59Ile missense variant moderate contig931 118189

IGV: Start, Jump

C/T
NGS:
0.026
C90:
0.000
HDS-2

UniProt

c.770A>G p.Asn257Ser missense variant moderate contig95 1990723

IGV: Start, Jump

A/G
NGS:
0.000
C90:
0.000
AAE1-2

UniProt

c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump

A/G
NGS:
0.123
C90:
0.000
AAE1-2

UniProt

c.947_948insTAGA p.Asp317fs frameshift variant high contig81 209908

IGV: Start, Jump

C/CATAG
NGS:
0.004
C90:
0.000
AAE1-2

UniProt

c.950_954delACCAA p.Asp317fs frameshift variant high contig81 209911

IGV: Start, Jump

GACCAA/G
NGS:
0.004
C90:
0.000
AAE1-2

UniProt

c.955_956insT p.Arg319fs frameshift variant high contig81 209917

IGV: Start, Jump

C/CT
NGS:
0.004
C90:
0.000
AAE1-2

UniProt

c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump

A/G
NGS:
0.116
C90:
0.000
AAE1-2

UniProt

c.1541T>C p.Val514Ala missense variant moderate contig81 210503

IGV: Start, Jump

T/C
NGS:
0.050
C90:
0.000
PHL-1

UniProt

c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump

T/C
NGS:
0.123
C90:
0.000
PHL-1

UniProt

c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump

T/C
NGS:
0.116
C90:
0.890
PHL-1

UniProt

c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump

T/C
NGS:
0.107
C90:
0.904
PHL-1

UniProt

c.407G>A p.Arg136Gln missense variant moderate contig1439 1491441

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.139
PHL-1

UniProt

c.176G>A p.Gly59Glu missense variant moderate contig1439 1492817

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.000
PHL-1

UniProt

c.175G>A p.Gly59Arg missense variant moderate contig1439 1492818

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.144
Edestin

UniProt

c.61G>A p.Ala21Thr missense variant moderate contig850 3065229

IGV: Start, Jump

C/T
NGS:
0.000
C90:
0.000
Edestin

UniProt

c.16T>C p.Ser6Pro missense variant moderate contig850 3065274

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.000
PKSG-2b

UniProt

c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump

A/T
NGS:
0.715
C90:
0.895
PKSG-2b

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump

G/C
NGS:
0.717
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1950704

IGV: Start, Jump

G/C
NGS:
0.410
C90:
0.000
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-2b

UniProt

c.-2_1dupATA start lost & conservative inframe insertion high contig700 1951880

IGV: Start, Jump

A/ATAT
NGS:
0.410
C90:
0.000
TFL1

UniProt

c.304G>A p.Asp102Asn missense variant & splice region variant moderate contig1636 520613

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.000
TFL1

UniProt

c.302-1G>A splice acceptor variant & intron variant high contig1636 520616

IGV: Start, Jump

C/T
NGS:
0.103
C90:
0.794
HDS-1

UniProt

c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump

T/C
NGS:
0.099
C90:
0.861
HDS-1

UniProt

c.1579T>C p.Tyr527His missense variant moderate contig1891 885975

IGV: Start, Jump

A/G
NGS:
0.002
C90:
0.000
HDS-1

UniProt

c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump

G/C
NGS:
0.125
C90:
0.943
HDS-1

UniProt

c.35G>A p.Cys12Tyr missense variant moderate contig1891 889357

IGV: Start, Jump

C/T
NGS:
0.094
C90:
0.646
HDS-1

UniProt

c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump

A/AC
NGS:
0.217
C90:
0.000
PIE1-2

UniProt

c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump

T/C
NGS:
0.061
C90:
0.268
PIE1-2

UniProt

c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump

A/T
NGS:
0.086
C90:
0.990
PIE1-2

UniProt

c.1630G>C p.Ala544Pro missense variant moderate contig1460 1191600

IGV: Start, Jump

C/G
NGS:
0.070
C90:
0.933
PIE1-2

UniProt

c.1450G>C p.Asp484His missense variant moderate contig1460 1191948

IGV: Start, Jump

C/G
NGS:
0.000
C90:
0.000
PIE1-2

UniProt

c.637T>A p.Ser213Thr missense variant moderate contig1460 1194421

IGV: Start, Jump

A/T
NGS:
0.079
C90:
0.885
PIE1-2

UniProt

c.580A>G p.Thr194Ala missense variant moderate contig1460 1194478

IGV: Start, Jump

T/C
NGS:
0.002
C90:
0.000
EMF2

UniProt

c.434C>T p.Ser145Phe missense variant moderate contig954 3049270

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.057
EMF2

UniProt

c.497G>T p.Gly166Val missense variant moderate contig954 3049426

IGV: Start, Jump

G/T
NGS:
0.000
C90:
0.000
EMF2

UniProt

c.722C>T p.Thr241Ile missense variant moderate contig954 3050302

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.062
EMF2

UniProt

c.1205C>T p.Ala402Val missense variant & splice region variant moderate contig954 3055694

IGV: Start, Jump

C/T
NGS:
0.015
C90:
0.053
EMF2

UniProt

c.1228A>G p.Ser410Gly missense variant moderate contig954 3055717

IGV: Start, Jump

A/G
NGS:
0.015
C90:
0.000
EMF2

UniProt

c.1315G>C p.Ala439Pro missense variant moderate contig954 3055804

IGV: Start, Jump

G/C
NGS:
0.015
C90:
0.053
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
EMF1-1

UniProt

c.278C>T p.Pro93Leu missense variant moderate contig883 269767

IGV: Start, Jump

C/T
NGS:
0.000
C90:
0.000
EMF1-1

UniProt

c.389G>A p.Arg130Gln missense variant moderate contig883 269878

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-1

UniProt

c.470C>A p.Ser157Tyr missense variant moderate contig883 269959

IGV: Start, Jump

C/A
NGS:
0.013
C90:
0.239
EMF1-1

UniProt

c.476A>T p.Asn159Ile missense variant moderate contig883 269965

IGV: Start, Jump

A/T
NGS:
0.007
C90:
0.000
EMF1-1

UniProt

c.590A>T p.Lys197Ile missense variant moderate contig883 270079

IGV: Start, Jump

A/T
NGS:
0.007
C90:
0.000
FT

UniProt

c.13C>G p.Leu5Val missense variant moderate contig1561 3124437

IGV: Start, Jump

C/G
NGS:
0.031
C90:
0.153
FT

UniProt

c.41_43dupATA p.Asn14dup disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump

T/TTAA
NGS:
0.020
C90:
0.000
FT

UniProt

c.421_422dupTA p.Leu142fs frameshift variant high contig1561 3126659

IGV: Start, Jump

C/CTA
NGS:
0.000
C90:
0.000
FT

UniProt

c.424C>A p.Leu142Ile missense variant moderate contig1561 3126663

IGV: Start, Jump

C/A
NGS:
0.000
C90:
0.000
aPT4

UniProt

c.16G>A p.Val6Ile missense variant moderate contig121 2828672

IGV: Start, Jump

G/A
NGS:
0.158
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.202T>A p.Leu68Ile missense variant moderate contig121 2828858

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump

T/C
NGS:
0.546
C90:
0.000
AAE1-3

UniProt

c.181G>A p.Val61Ile missense variant moderate contig976 1083894

IGV: Start, Jump

C/T
NGS:
0.055
C90:
0.000
AAE1-3

UniProt

c.14C>T p.Ala5Val missense variant moderate contig976 1084061

IGV: Start, Jump

G/A
NGS:
0.004
C90:
0.000
GGR

UniProt

c.854T>A p.Leu285Gln missense variant moderate contig2282 549846

IGV: Start, Jump

T/A
NGS:
0.000
C90:
0.000
PKSB-3

UniProt

c.1652A>G p.Glu551Gly missense variant moderate contig93 3339759

IGV: Start, Jump

A/G
NGS:
0.088
C90:
0.000
PKSB-3

UniProt

c.1880_1891delATGGCCATGGCC p.His627_Gly630del disruptive inframe deletion moderate contig93 3339981

IGV: Start, Jump

CTGGCCATGGCCA/C
NGS:
0.004
C90:
0.000
PKSB-3

UniProt

c.1901C>G p.Ala634Gly missense variant moderate contig93 3340008

IGV: Start, Jump

C/G
NGS:
0.059
C90:
0.000

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4450135
Overlapping SNPs:
19
Concordance:
14

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495214
Overlapping SNPs:
4
Concordance:
4
QR code for SRR14708203

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings