XGL1

SRR 14708209

Grower: Lanzhou University, Guangpeng Ren

General Information

Accession Date
May 31, 2021
Reported Plant Sex
unknown

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.72%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0204
male female SRR14708209

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.8G>A p.Cys3Tyr missense variant moderate contig1772 2082234

IGV: Start, Jump

G/A
NGS:
0.057
C90:
0.000
CBDAS c.428A>G p.His143Arg missense variant moderate contig1772 2082654

IGV: Start, Jump

A/G
NGS:
0.000
C90:
0.000

Variants (Select Genes of Interest)

GPPs1

UniProt

c.472T>A p.Leu158Met missense variant moderate contig676 168721

IGV: Start, Jump

T/A
NGS:
0.020
C90:
0.000
GPPs1

UniProt

c.744C>G p.Asp248Glu missense variant moderate contig676 168993

IGV: Start, Jump

C/G
NGS:
0.022
C90:
0.000
GPPs1

UniProt

c.807_814delGCATTTTT p.His270fs frameshift variant high contig676 169595

IGV: Start, Jump

GTGCATTTT/G
NGS:
0.015
C90:
0.000
GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
GPPs1

UniProt

c.857_864delCGAAAGAG p.Ala286fs frameshift variant high contig676 169645

IGV: Start, Jump

GGCGAAAGA/G
NGS:
0.009
C90:
0.000
GPPs1

UniProt

c.866_877delTACTAGAGCTAG p.Leu289_Glu293delinsTer stop gained & disruptive inframe deletion high contig676 169655

IGV: Start, Jump

TTACTAGAGCTAG/T
NGS:
0.009
C90:
0.000
GPPs1

UniProt

c.896A>G p.Asn299Ser missense variant moderate contig676 169772

IGV: Start, Jump

A/G
NGS:
0.046
C90:
0.000
GPPs1

UniProt

c.923_927+5delTTTTGGTACT p.Val308fs frameshift variant & splice donor variant & splice region variant & intron variant high contig676 169798

IGV: Start, Jump

GTTTTGGTACT/G
NGS:
0.009
C90:
0.000
GPPs1

UniProt

c.931delT p.Ter311fs frameshift variant & stop lost & splice region variant high contig676 169840

IGV: Start, Jump

AT/A
NGS:
0.009
C90:
0.000
EMF1-2

UniProt

c.3G>T p.Met1? start lost high contig885 103

IGV: Start, Jump

G/T
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.476T>C p.Leu159Pro missense variant moderate contig885 576

IGV: Start, Jump

T/C
NGS:
0.000
C90:
0.000
EMF1-2

UniProt

c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

A/C
NGS:
0.090
C90:
0.474
EMF1-2

UniProt

c.1148C>T p.Ala383Val missense variant moderate contig885 2034

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1187T>C p.Leu396Ser missense variant moderate contig885 2073

IGV: Start, Jump

T/C
NGS:
0.026
C90:
0.000
EMF1-2

UniProt

c.1189G>A p.Ala397Thr missense variant moderate contig885 2075

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1199G>A p.Arg400Lys missense variant moderate contig885 2085

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1409G>A p.Arg470Lys missense variant moderate contig885 2295

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1828A>G p.Ile610Val missense variant moderate contig885 2714

IGV: Start, Jump

A/G
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.2008C>T p.Pro670Ser missense variant moderate contig885 2894

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.2256A>T p.Lys752Asn missense variant moderate contig885 3142

IGV: Start, Jump

A/T
NGS:
0.026
C90:
0.000
EMF1-2

UniProt

c.2653A>G p.Thr885Ala missense variant moderate contig885 3539

IGV: Start, Jump

A/G
NGS:
0.007
C90:
0.000
PHL-2 c.61G>A p.Val21Ile missense variant moderate contig2621 337630

IGV: Start, Jump

G/A
NGS:
0.002
C90:
0.000
PHL-2 c.932T>C p.Leu311Pro missense variant moderate contig2621 340210

IGV: Start, Jump

T/C
NGS:
0.039
C90:
0.268
PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

A/G
NGS:
0.096
C90:
0.555
PHL-2 c.1096G>A p.Ala366Thr missense variant moderate contig2621 340374

IGV: Start, Jump

G/A
NGS:
0.090
C90:
0.531
PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

T/A
NGS:
0.064
C90:
0.732
PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.746
PHL-2 c.2624C>T p.Ser875Phe missense variant moderate contig2621 342667

IGV: Start, Jump

C/T
NGS:
0.042
C90:
0.268
PHL-2 c.2756A>C p.Glu919Ala missense variant moderate contig2621 342799

IGV: Start, Jump

A/C
NGS:
0.064
C90:
0.675
PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

G/A
NGS:
0.107
C90:
0.890
PHL-2 c.2830A>C p.Asn944His missense variant moderate contig2621 342873

IGV: Start, Jump

A/C
NGS:
0.044
C90:
0.000
PHL-2 c.2933G>T p.Arg978Leu missense variant moderate contig2621 342976

IGV: Start, Jump

G/T
NGS:
0.048
C90:
0.297
PHL-2 c.2936T>G p.Val979Gly missense variant moderate contig2621 342979

IGV: Start, Jump

T/G
NGS:
0.048
C90:
0.000
PHL-2 c.3002A>G p.Tyr1001Cys missense variant moderate contig2621 343045

IGV: Start, Jump

A/G
NGS:
0.055
C90:
0.316
PHL-2 c.3027G>T p.Lys1009Asn missense variant moderate contig2621 343070

IGV: Start, Jump

G/T
NGS:
0.055
C90:
0.311
PHL-2 c.3033T>G p.Cys1011Trp missense variant moderate contig2621 343076

IGV: Start, Jump

T/G
NGS:
0.055
C90:
0.292
PHL-2 c.3209A>G p.Gln1070Arg missense variant moderate contig2621 343252

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.885
PHL-2 c.3467A>G p.Gln1156Arg missense variant moderate contig2621 343510

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.713
PKSG-4b

UniProt

c.535_545delATTGGAGTGGG p.Ile179fs frameshift variant high contig700 2721127

IGV: Start, Jump

CCCCACTCCAAT/C
NGS:
0.105
C90:
0.000
PKSG-4b

UniProt

c.523C>T p.His175Tyr missense variant moderate contig700 2721150

IGV: Start, Jump

G/A
NGS:
0.112
C90:
0.325
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.324A>C p.Glu108Asp missense variant moderate contig700 2721349

IGV: Start, Jump

T/G
NGS:
0.094
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
PKSG-4b

UniProt

c.316+2T>A splice donor variant & intron variant high contig700 2723818

IGV: Start, Jump

A/T
NGS:
0.070
C90:
0.689
PKSG-4b

UniProt

c.229G>A p.Gly77Ser missense variant moderate contig700 2724206

IGV: Start, Jump

C/T
NGS:
0.042
C90:
0.000
PKSG-4b

UniProt

c.216G>C p.Leu72Phe missense variant moderate contig700 2724219

IGV: Start, Jump

C/G
NGS:
0.044
C90:
0.000
PKSG-4b

UniProt

c.206T>C p.Leu69Ser missense variant moderate contig700 2724229

IGV: Start, Jump

A/G
NGS:
0.044
C90:
0.000
PKSG-4a

UniProt

c.336_337insAC p.Val113fs frameshift variant high contig700 1937747

IGV: Start, Jump

T/TAC
NGS:
0.000
C90:
0.000
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2a

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1944258

IGV: Start, Jump

G/C
NGS:
0.009
C90:
0.000
AAE1-1

UniProt

c.1580A>G p.Asn527Ser missense variant moderate contig606 3242691

IGV: Start, Jump

T/C
NGS:
0.004
C90:
0.000
AAE1-1

UniProt

c.1504G>A p.Asp502Asn missense variant moderate contig606 3242767

IGV: Start, Jump

C/T
NGS:
0.004
C90:
0.000
AAE1-1

UniProt

c.454A>G p.Lys152Glu missense variant moderate contig606 3243817

IGV: Start, Jump

T/C
NGS:
0.007
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
DXR-2

UniProt

c.431C>G p.Ala144Gly missense variant moderate contig380 287760

IGV: Start, Jump

G/C
NGS:
0.182
C90:
0.550
FAD2-2

UniProt

c.161T>A p.Leu54His missense variant moderate contig83 1803208

IGV: Start, Jump

A/T
NGS:
0.156
C90:
0.000
FAD2-2

UniProt

c.127C>T p.Arg43* stop gained high contig83 1803242

IGV: Start, Jump

G/A
NGS:
0.000
C90:
0.000
ELF3

UniProt

c.358G>A p.Gly120Arg missense variant moderate contig97 242064

IGV: Start, Jump

G/A
NGS:
0.099
C90:
0.493
ELF3

UniProt

c.520A>C p.Asn174His missense variant moderate contig97 242226

IGV: Start, Jump

A/C
NGS:
0.094
C90:
0.502
ELF3

UniProt

c.556G>A p.Glu186Lys missense variant moderate contig97 242262

IGV: Start, Jump

G/A
NGS:
0.000
C90:
0.000
ELF3

UniProt

c.574A>G p.Asn192Asp missense variant moderate contig97 242280

IGV: Start, Jump

A/G
NGS:
0.042
C90:
0.579
ELF3

UniProt

c.757C>T p.Pro253Ser missense variant moderate contig97 242463

IGV: Start, Jump

C/T
NGS:
0.020
C90:
0.048
ELF3

UniProt

c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump

A/G
NGS:
0.112
C90:
0.000
ELF3

UniProt

c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump

G/C
NGS:
0.114
C90:
0.938
ELF3

UniProt

c.1366T>G p.Leu456Val missense variant moderate contig97 244197

IGV: Start, Jump

T/G
NGS:
0.015
C90:
0.000
ELF3

UniProt

c.1385C>T p.Ala462Val missense variant moderate contig97 244216

IGV: Start, Jump

C/T
NGS:
0.004
C90:
0.000
ELF3

UniProt

c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump

G/A
NGS:
0.123
C90:
0.000
ELF3

UniProt

c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.545
ELF3

UniProt

c.1832A>G p.Tyr611Cys missense variant moderate contig97 244663

IGV: Start, Jump

A/G
NGS:
0.004
C90:
0.000
ELF3

UniProt

c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump

C/G
NGS:
0.123
C90:
0.632
ELF3

UniProt

c.2128C>G p.His710Asp missense variant moderate contig97 244959

IGV: Start, Jump

C/G
NGS:
0.004
C90:
0.000
ELF3

UniProt

c.2140C>T p.Pro714Ser missense variant moderate contig97 244971

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.038
ELF3

UniProt

c.2141C>G p.Pro714Arg missense variant moderate contig97 244972

IGV: Start, Jump

C/G
NGS:
0.088
C90:
0.335
ELF3

UniProt

c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump

G/T
NGS:
0.125
C90:
0.531
ELF5

UniProt

c.520A>G p.Thr174Ala missense variant moderate contig382 880382

IGV: Start, Jump

A/G
NGS:
0.015
C90:
0.048
aPT1

UniProt

c.95_97delGTT p.Cys32del disruptive inframe deletion moderate contig121 2835800

IGV: Start, Jump

ATGT/A
NGS:
0.118
C90:
0.311
aPT1

UniProt

c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump

A/G
NGS:
0.579
C90:
0.761
AAE1-2

UniProt

c.285_290dupCTCATC p.Ser96_Ser97dup disruptive inframe insertion moderate contig81 209243

IGV: Start, Jump

A/AATCCTC
NGS:
0.002
C90:
0.000
AAE1-2

UniProt

c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump

A/G
NGS:
0.123
C90:
0.000
AAE1-2

UniProt

c.374A>G p.His125Arg missense variant moderate contig81 209336

IGV: Start, Jump

A/G
NGS:
0.026
C90:
0.000
AAE1-2

UniProt

c.688G>A p.Asp230Asn missense variant moderate contig81 209650

IGV: Start, Jump

G/A
NGS:
0.018
C90:
0.000
AAE1-2

UniProt

c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump

A/G
NGS:
0.116
C90:
0.000
AAE1-2

UniProt

c.1102C>A p.His368Asn missense variant moderate contig81 210064

IGV: Start, Jump

C/A
NGS:
0.033
C90:
0.000
AAE1-2

UniProt

c.1115A>G p.Glu372Gly missense variant moderate contig81 210077

IGV: Start, Jump

A/G
NGS:
0.004
C90:
0.000
AAE1-2

UniProt

c.1330_1331insTTA p.Thr443_Asn444insIle disruptive inframe insertion moderate contig81 210290

IGV: Start, Jump

C/CTAT
NGS:
0.000
C90:
0.000
AAE1-2

UniProt

c.1415G>A p.Ser472Asn missense variant moderate contig81 210377

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1417A>G p.Thr473Ala missense variant moderate contig81 210379

IGV: Start, Jump

A/G
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1434G>T p.Glu478Asp missense variant moderate contig81 210396

IGV: Start, Jump

G/T
NGS:
0.075
C90:
0.000
AAE1-2

UniProt

c.1541T>C p.Val514Ala missense variant moderate contig81 210503

IGV: Start, Jump

T/C
NGS:
0.050
C90:
0.000
PHL-1

UniProt

c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump

T/C
NGS:
0.123
C90:
0.000
PHL-1

UniProt

c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump

T/C
NGS:
0.116
C90:
0.890
PHL-1

UniProt

c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump

T/C
NGS:
0.107
C90:
0.904
Edestin

UniProt

c.41C>T p.Ala14Val missense variant moderate contig850 3065249

IGV: Start, Jump

G/A
NGS:
0.009
C90:
0.000
Edestin

UniProt

c.16T>C p.Ser6Pro missense variant moderate contig850 3065274

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.000
PKSG-2b

UniProt

c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump

A/T
NGS:
0.715
C90:
0.895
PKSG-2b

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump

C/T
NGS:
0.366
C90:
0.947
PKSG-2b

UniProt

c.718T>A p.Phe240Ile missense variant moderate contig700 1950920

IGV: Start, Jump

A/T
NGS:
0.114
C90:
0.000
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
HDS-1

UniProt

c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump

T/C
NGS:
0.099
C90:
0.861
HDS-1

UniProt

c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump

C/T
NGS:
0.167
C90:
0.000
HDS-1

UniProt

c.136G>A p.Val46Ile missense variant moderate contig1891 889256

IGV: Start, Jump

C/T
NGS:
0.088
C90:
0.593
HDS-1

UniProt

c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump

G/C
NGS:
0.125
C90:
0.943
HDS-1

UniProt

c.35G>A p.Cys12Tyr missense variant moderate contig1891 889357

IGV: Start, Jump

C/T
NGS:
0.094
C90:
0.646
HDS-1

UniProt

c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump

A/AC
NGS:
0.217
C90:
0.000
PIE1-2

UniProt

c.6785A>T p.Asp2262Val missense variant moderate contig1460 1184302

IGV: Start, Jump

T/A
NGS:
0.000
C90:
0.000
PIE1-2

UniProt

c.6653A>G p.Asn2218Ser missense variant moderate contig1460 1184434

IGV: Start, Jump

T/C
NGS:
0.059
C90:
0.928
PIE1-2

UniProt

c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump

T/C
NGS:
0.061
C90:
0.268
PIE1-2

UniProt

c.5884G>A p.Gly1962Ser missense variant moderate contig1460 1185715

IGV: Start, Jump

C/T
NGS:
0.004
C90:
0.019
PIE1-2

UniProt

c.3554G>A p.Arg1185Lys missense variant moderate contig1460 1188486

IGV: Start, Jump

C/T
NGS:
0.002
C90:
0.014
PIE1-2

UniProt

c.2083_2085delGTC p.Val695del conservative inframe deletion moderate contig1460 1189954

IGV: Start, Jump

GGAC/G
NGS:
0.046
C90:
0.880
PIE1-2

UniProt

c.2072A>G p.His691Arg missense variant moderate contig1460 1189968

IGV: Start, Jump

T/C
NGS:
0.046
C90:
0.789
PIE1-2

UniProt

c.2027A>T p.Gln676Leu missense variant moderate contig1460 1190013

IGV: Start, Jump

T/A
NGS:
0.004
C90:
0.014
PIE1-2

UniProt

c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump

A/T
NGS:
0.086
C90:
0.990
PIE1-2

UniProt

c.1630G>C p.Ala544Pro missense variant moderate contig1460 1191600

IGV: Start, Jump

C/G
NGS:
0.070
C90:
0.933
PIE1-2

UniProt

c.1324G>T p.Val442Leu missense variant moderate contig1460 1192074

IGV: Start, Jump

C/A
NGS:
0.000
C90:
0.000
PIE1-2

UniProt

c.1313A>T p.Glu438Val missense variant moderate contig1460 1192085

IGV: Start, Jump

T/A
NGS:
0.000
C90:
0.000
PIE1-2

UniProt

c.1289A>G p.Asp430Gly missense variant moderate contig1460 1192109

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
PIE1-2

UniProt

c.1156T>G p.Trp386Gly missense variant moderate contig1460 1192242

IGV: Start, Jump

A/C
NGS:
0.009
C90:
0.976
PIE1-2

UniProt

c.1117C>G p.Gln373Glu missense variant moderate contig1460 1192281

IGV: Start, Jump

G/C
NGS:
0.002
C90:
0.818
PIE1-2

UniProt

c.1093G>A p.Gly365Ser missense variant moderate contig1460 1192305

IGV: Start, Jump

C/T
NGS:
0.002
C90:
0.986
PIE1-2

UniProt

c.982G>A p.Glu328Lys missense variant moderate contig1460 1192416

IGV: Start, Jump

C/T
NGS:
0.050
C90:
0.976
PIE1-2

UniProt

c.710C>T p.Pro237Leu missense variant moderate contig1460 1193804

IGV: Start, Jump

G/A
NGS:
0.072
C90:
0.866
PIE1-2

UniProt

c.706T>C p.Tyr236His missense variant moderate contig1460 1193808

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.737
PIE1-2

UniProt

c.637T>A p.Ser213Thr missense variant moderate contig1460 1194421

IGV: Start, Jump

A/T
NGS:
0.079
C90:
0.885
EMF2

UniProt

c.361A>G p.Asn121Asp missense variant moderate contig954 3049197

IGV: Start, Jump

A/G
NGS:
0.000
C90:
0.000
EMF2

UniProt

c.434C>T p.Ser145Phe missense variant moderate contig954 3049270

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.057
EMF2

UniProt

c.645G>A p.Met215Ile missense variant moderate contig954 3050032

IGV: Start, Jump

G/A
NGS:
0.000
C90:
0.000
EMF2

UniProt

c.722C>T p.Thr241Ile missense variant moderate contig954 3050302

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.062
EMF2

UniProt

c.1205C>T p.Ala402Val missense variant & splice region variant moderate contig954 3055694

IGV: Start, Jump

C/T
NGS:
0.015
C90:
0.053
EMF2

UniProt

c.1228A>G p.Ser410Gly missense variant moderate contig954 3055717

IGV: Start, Jump

A/G
NGS:
0.015
C90:
0.000
EMF2

UniProt

c.1315G>C p.Ala439Pro missense variant moderate contig954 3055804

IGV: Start, Jump

G/C
NGS:
0.015
C90:
0.053
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
EMF1-1

UniProt

c.62C>G p.Thr21Ser missense variant moderate contig883 268910

IGV: Start, Jump

C/G
NGS:
0.007
C90:
0.000
EMF1-1

UniProt

c.389G>A p.Arg130Gln missense variant moderate contig883 269878

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-1

UniProt

c.476A>T p.Asn159Ile missense variant moderate contig883 269965

IGV: Start, Jump

A/T
NGS:
0.007
C90:
0.000
EMF1-1

UniProt

c.590A>T p.Lys197Ile missense variant moderate contig883 270079

IGV: Start, Jump

A/T
NGS:
0.007
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.198A>C p.Lys66Asn missense variant moderate contig121 2828854

IGV: Start, Jump

A/C
NGS:
0.044
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.517A>T p.Ile173Leu missense variant & splice region variant moderate contig121 2830795

IGV: Start, Jump

A/T
NGS:
0.022
C90:
0.000
aPT4

UniProt

c.757G>T p.Val253Leu missense variant moderate contig121 2831364

IGV: Start, Jump

G/T
NGS:
0.039
C90:
0.000
aPT4

UniProt

c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump

T/C
NGS:
0.546
C90:
0.000
FLD

UniProt

c.2981T>C p.Met994Thr missense variant moderate contig1450 2044012

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.478
FLD

UniProt

c.2964C>A p.Asp988Glu missense variant moderate contig1450 2044029

IGV: Start, Jump

G/T
NGS:
0.057
C90:
0.464
FLD

UniProt

c.2929T>C p.Phe977Leu missense variant moderate contig1450 2044103

IGV: Start, Jump

A/G
NGS:
0.026
C90:
0.349
FLD

UniProt

c.2869C>T p.His957Tyr missense variant moderate contig1450 2044163

IGV: Start, Jump

G/A
NGS:
0.011
C90:
0.000
FLD

UniProt

c.2831A>G p.Glu944Gly missense variant moderate contig1450 2044201

IGV: Start, Jump

T/C
NGS:
0.011
C90:
0.000
FLD

UniProt

c.125G>A p.Ser42Asn missense variant moderate contig1450 2047909

IGV: Start, Jump

C/T
NGS:
0.037
C90:
0.388
PKSA-3a

UniProt

c.709C>G p.Leu237Val missense variant moderate contig1357 1145222

IGV: Start, Jump

C/G
NGS:
0.004
C90:
0.000
AAE1-3

UniProt

c.722G>A p.Arg241Lys missense variant moderate contig976 1083132

IGV: Start, Jump

C/T
NGS:
0.070
C90:
0.000
AAE1-3

UniProt

c.659G>A p.Arg220Gln missense variant moderate contig976 1083195

IGV: Start, Jump

C/T
NGS:
0.077
C90:
0.000
AAE1-3

UniProt

c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump

C/G
NGS:
0.116
C90:
0.000
AAE1-3

UniProt

c.586-28_608delGACACCTTGTGCGTTCATTAATGTGAAGAGTGATGCTAATGTCAGTGGTGA p.Ser196fs frameshift variant & splice acceptor variant & splice region variant & intron variant high contig976 1083245

IGV: Start, Jump

ATCACCACTGACATTAGCATCACTCTTCACATTAATGAACGCACAAGGTGTC/A
NGS:
0.000
C90:
0.000
AAE1-3

UniProt

c.338_339delCT p.Pro113fs frameshift variant high contig976 1083685

IGV: Start, Jump

TAG/T
NGS:
0.000
C90:
0.000
AAE1-3

UniProt

c.296C>T p.Pro99Leu missense variant moderate contig976 1083729

IGV: Start, Jump

G/A
NGS:
0.046
C90:
0.000
AAE1-3

UniProt

c.199A>G p.Asn67Asp missense variant moderate contig976 1083876

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
AAE1-3

UniProt

c.188A>G p.Asn63Ser missense variant moderate contig976 1083887

IGV: Start, Jump

T/C
NGS:
0.077
C90:
0.000
AAE1-3

UniProt

c.3G>A p.Met1? start lost high contig976 1084072

IGV: Start, Jump

C/T
NGS:
0.046
C90:
0.416
FAD7A-1

UniProt

c.*320_*342+3delTCTCTCTCTCTCTCTCTCTCTATATA splice donor variant & splice region variant & 3 prime UTR variant & intron variant high contig510 71447

IGV: Start, Jump

CTCTCTCTCTCTCTCTCTCTCTATATA/C
NGS:
0.002
C90:
0.000
FAD7A-1

UniProt

c.*328_*342+3delTCTCTCTCTCTCTATATA splice donor variant & splice region variant & 3 prime UTR variant & intron variant high contig510 71455

IGV: Start, Jump

CTCTCTCTCTCTCTATATA/C
NGS:
0.000
C90:
0.000
PIE1-1

UniProt

c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump

C/G
NGS:
0.096
C90:
0.852
PIE1-1

UniProt

c.3038G>A p.Arg1013His missense variant moderate contig1225 2284653

IGV: Start, Jump

G/A
NGS:
0.000
C90:
0.000
GGR

UniProt

c.248G>T p.Arg83Met missense variant moderate contig2282 549240

IGV: Start, Jump

G/T
NGS:
0.000
C90:
0.000
GGR

UniProt

c.376G>C p.Glu126Gln missense variant moderate contig2282 549368

IGV: Start, Jump

G/C
NGS:
0.015
C90:
0.110
GGR

UniProt

c.382C>T p.Leu128Phe missense variant moderate contig2282 549374

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.000
GGR

UniProt

c.456T>A p.His152Gln missense variant moderate contig2282 549448

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
GGR

UniProt

c.460G>A p.Asp154Asn missense variant moderate contig2282 549452

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
GGR

UniProt

c.620A>G p.Lys207Arg missense variant moderate contig2282 549612

IGV: Start, Jump

A/G
NGS:
0.000
C90:
0.000
GGR

UniProt

c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump

A/T
NGS:
0.121
C90:
0.000
PKSB-3

UniProt

c.64A>C p.Ser22Arg missense variant moderate contig93 3333355

IGV: Start, Jump

A/C
NGS:
0.000
C90:
0.000

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4448770
Overlapping SNPs:
17
Concordance:
12

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495167
Overlapping SNPs:
3
Concordance:
3
QR code for SRR14708209

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings