SRR 14708209

Grower: Lanzhou University, Guangpeng Ren

General Information

Accession Date
May 31, 2021
Reported Plant Sex
not reported

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.


No information provided.


No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.72%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0204
male female SRR14708209

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.8G>A p.Cys3Tyr missense variant moderate contig1772 2082234

IGV: Start, Jump

CBDAS c.428A>G p.His143Arg missense variant moderate contig1772 2082654

IGV: Start, Jump


Variants (Select Genes of Interest)



c.472T>A p.Leu158Met missense variant moderate contig676 168721

IGV: Start, Jump



c.744C>G p.Asp248Glu missense variant moderate contig676 168993

IGV: Start, Jump



c.807_814delGCATTTTT p.His270fs frameshift variant high contig676 169595

IGV: Start, Jump



c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump



c.857_864delCGAAAGAG p.Ala286fs frameshift variant high contig676 169645

IGV: Start, Jump



c.866_877delTACTAGAGCTAG p.Leu289_Glu293delinsTer stop gained & disruptive inframe deletion high contig676 169655

IGV: Start, Jump



c.896A>G p.Asn299Ser missense variant moderate contig676 169772

IGV: Start, Jump



c.923_927+5delTTTTGGTACT p.Val308fs frameshift variant & splice donor variant & splice region variant & intron variant high contig676 169798

IGV: Start, Jump



c.931delT p.Ter311fs frameshift variant & stop lost & splice region variant high contig676 169840

IGV: Start, Jump



c.3G>T p.Met1? start lost high contig885 103

IGV: Start, Jump



c.476T>C p.Leu159Pro missense variant moderate contig885 576

IGV: Start, Jump



c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump



c.1148C>T p.Ala383Val missense variant moderate contig885 2034

IGV: Start, Jump



c.1187T>C p.Leu396Ser missense variant moderate contig885 2073

IGV: Start, Jump



c.1189G>A p.Ala397Thr missense variant moderate contig885 2075

IGV: Start, Jump



c.1199G>A p.Arg400Lys missense variant moderate contig885 2085

IGV: Start, Jump



c.1409G>A p.Arg470Lys missense variant moderate contig885 2295

IGV: Start, Jump



c.1828A>G p.Ile610Val missense variant moderate contig885 2714

IGV: Start, Jump



c.2008C>T p.Pro670Ser missense variant moderate contig885 2894

IGV: Start, Jump



c.2256A>T p.Lys752Asn missense variant moderate contig885 3142

IGV: Start, Jump



c.2653A>G p.Thr885Ala missense variant moderate contig885 3539

IGV: Start, Jump

PHL-2 c.61G>A p.Val21Ile missense variant moderate contig2621 337630

IGV: Start, Jump

PHL-2 c.932T>C p.Leu311Pro missense variant moderate contig2621 340210

IGV: Start, Jump

PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

PHL-2 c.1096G>A p.Ala366Thr missense variant moderate contig2621 340374

IGV: Start, Jump

PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

PHL-2 c.2624C>T p.Ser875Phe missense variant moderate contig2621 342667

IGV: Start, Jump

PHL-2 c.2756A>C p.Glu919Ala missense variant moderate contig2621 342799

IGV: Start, Jump

PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

PHL-2 c.2830A>C p.Asn944His missense variant moderate contig2621 342873

IGV: Start, Jump

PHL-2 c.2933G>T p.Arg978Leu missense variant moderate contig2621 342976

IGV: Start, Jump

PHL-2 c.2936T>G p.Val979Gly missense variant moderate contig2621 342979

IGV: Start, Jump

PHL-2 c.3002A>G p.Tyr1001Cys missense variant moderate contig2621 343045

IGV: Start, Jump

PHL-2 c.3027G>T p.Lys1009Asn missense variant moderate contig2621 343070

IGV: Start, Jump

PHL-2 c.3033T>G p.Cys1011Trp missense variant moderate contig2621 343076

IGV: Start, Jump

PHL-2 c.3209A>G p.Gln1070Arg missense variant moderate contig2621 343252

IGV: Start, Jump

PHL-2 c.3467A>G p.Gln1156Arg missense variant moderate contig2621 343510

IGV: Start, Jump



c.535_545delATTGGAGTGGG p.Ile179fs frameshift variant high contig700 2721127

IGV: Start, Jump



c.523C>T p.His175Tyr missense variant moderate contig700 2721150

IGV: Start, Jump



c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump



c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump



c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump



c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump



c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump



c.324A>C p.Glu108Asp missense variant moderate contig700 2721349

IGV: Start, Jump



c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump



c.316+2T>A splice donor variant & intron variant high contig700 2723818

IGV: Start, Jump



c.229G>A p.Gly77Ser missense variant moderate contig700 2724206

IGV: Start, Jump



c.216G>C p.Leu72Phe missense variant moderate contig700 2724219

IGV: Start, Jump



c.206T>C p.Leu69Ser missense variant moderate contig700 2724229

IGV: Start, Jump



c.336_337insAC p.Val113fs frameshift variant high contig700 1937747

IGV: Start, Jump



c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump



c.1132C>G p.Leu378Val missense variant moderate contig700 1944258

IGV: Start, Jump



c.1580A>G p.Asn527Ser missense variant moderate contig606 3242691

IGV: Start, Jump



c.1504G>A p.Asp502Asn missense variant moderate contig606 3242767

IGV: Start, Jump



c.454A>G p.Lys152Glu missense variant moderate contig606 3243817

IGV: Start, Jump



c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump



c.431C>G p.Ala144Gly missense variant moderate contig380 287760

IGV: Start, Jump



c.161T>A p.Leu54His missense variant moderate contig83 1803208

IGV: Start, Jump



c.127C>T p.Arg43* stop gained high contig83 1803242

IGV: Start, Jump



c.358G>A p.Gly120Arg missense variant moderate contig97 242064

IGV: Start, Jump



c.520A>C p.Asn174His missense variant moderate contig97 242226

IGV: Start, Jump



c.556G>A p.Glu186Lys missense variant moderate contig97 242262

IGV: Start, Jump



c.574A>G p.Asn192Asp missense variant moderate contig97 242280

IGV: Start, Jump



c.757C>T p.Pro253Ser missense variant moderate contig97 242463

IGV: Start, Jump



c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump



c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump



c.1366T>G p.Leu456Val missense variant moderate contig97 244197

IGV: Start, Jump



c.1385C>T p.Ala462Val missense variant moderate contig97 244216

IGV: Start, Jump



c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump



c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump



c.1832A>G p.Tyr611Cys missense variant moderate contig97 244663

IGV: Start, Jump



c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump



c.2128C>G p.His710Asp missense variant moderate contig97 244959

IGV: Start, Jump



c.2140C>T p.Pro714Ser missense variant moderate contig97 244971

IGV: Start, Jump



c.2141C>G p.Pro714Arg missense variant moderate contig97 244972

IGV: Start, Jump



c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump



c.520A>G p.Thr174Ala missense variant moderate contig382 880382

IGV: Start, Jump



c.95_97delGTT p.Cys32del disruptive inframe deletion moderate contig121 2835800

IGV: Start, Jump



c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump



c.285_290dupCTCATC p.Ser96_Ser97dup disruptive inframe insertion moderate contig81 209243

IGV: Start, Jump



c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump



c.374A>G p.His125Arg missense variant moderate contig81 209336

IGV: Start, Jump



c.688G>A p.Asp230Asn missense variant moderate contig81 209650

IGV: Start, Jump



c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump



c.1102C>A p.His368Asn missense variant moderate contig81 210064

IGV: Start, Jump



c.1115A>G p.Glu372Gly missense variant moderate contig81 210077

IGV: Start, Jump



c.1330_1331insTTA p.Thr443_Asn444insIle disruptive inframe insertion moderate contig81 210290

IGV: Start, Jump



c.1415G>A p.Ser472Asn missense variant moderate contig81 210377

IGV: Start, Jump



c.1417A>G p.Thr473Ala missense variant moderate contig81 210379

IGV: Start, Jump



c.1434G>T p.Glu478Asp missense variant moderate contig81 210396

IGV: Start, Jump



c.1541T>C p.Val514Ala missense variant moderate contig81 210503

IGV: Start, Jump



c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump



c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump



c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump



c.41C>T p.Ala14Val missense variant moderate contig850 3065249

IGV: Start, Jump



c.16T>C p.Ser6Pro missense variant moderate contig850 3065274

IGV: Start, Jump



c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump



c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump



c.718T>A p.Phe240Ile missense variant moderate contig700 1950920

IGV: Start, Jump



c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump



c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump



c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump



c.136G>A p.Val46Ile missense variant moderate contig1891 889256

IGV: Start, Jump



c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump



c.35G>A p.Cys12Tyr missense variant moderate contig1891 889357

IGV: Start, Jump



c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump



c.6785A>T p.Asp2262Val missense variant moderate contig1460 1184302

IGV: Start, Jump



c.6653A>G p.Asn2218Ser missense variant moderate contig1460 1184434

IGV: Start, Jump



c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump



c.5884G>A p.Gly1962Ser missense variant moderate contig1460 1185715

IGV: Start, Jump



c.3554G>A p.Arg1185Lys missense variant moderate contig1460 1188486

IGV: Start, Jump



c.2083_2085delGTC p.Val695del conservative inframe deletion moderate contig1460 1189954

IGV: Start, Jump



c.2072A>G p.His691Arg missense variant moderate contig1460 1189968

IGV: Start, Jump



c.2027A>T p.Gln676Leu missense variant moderate contig1460 1190013

IGV: Start, Jump



c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump



c.1630G>C p.Ala544Pro missense variant moderate contig1460 1191600

IGV: Start, Jump



c.1324G>T p.Val442Leu missense variant moderate contig1460 1192074

IGV: Start, Jump



c.1313A>T p.Glu438Val missense variant moderate contig1460 1192085

IGV: Start, Jump



c.1289A>G p.Asp430Gly missense variant moderate contig1460 1192109

IGV: Start, Jump



c.1156T>G p.Trp386Gly missense variant moderate contig1460 1192242

IGV: Start, Jump



c.1117C>G p.Gln373Glu missense variant moderate contig1460 1192281

IGV: Start, Jump



c.1093G>A p.Gly365Ser missense variant moderate contig1460 1192305

IGV: Start, Jump



c.982G>A p.Glu328Lys missense variant moderate contig1460 1192416

IGV: Start, Jump



c.710C>T p.Pro237Leu missense variant moderate contig1460 1193804

IGV: Start, Jump



c.706T>C p.Tyr236His missense variant moderate contig1460 1193808

IGV: Start, Jump



c.637T>A p.Ser213Thr missense variant moderate contig1460 1194421

IGV: Start, Jump



c.361A>G p.Asn121Asp missense variant moderate contig954 3049197

IGV: Start, Jump



c.434C>T p.Ser145Phe missense variant moderate contig954 3049270

IGV: Start, Jump



c.645G>A p.Met215Ile missense variant moderate contig954 3050032

IGV: Start, Jump



c.722C>T p.Thr241Ile missense variant moderate contig954 3050302

IGV: Start, Jump



c.1205C>T p.Ala402Val missense variant & splice region variant moderate contig954 3055694

IGV: Start, Jump



c.1228A>G p.Ser410Gly missense variant moderate contig954 3055717

IGV: Start, Jump



c.1315G>C p.Ala439Pro missense variant moderate contig954 3055804

IGV: Start, Jump



c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump



c.62C>G p.Thr21Ser missense variant moderate contig883 268910

IGV: Start, Jump



c.389G>A p.Arg130Gln missense variant moderate contig883 269878

IGV: Start, Jump



c.476A>T p.Asn159Ile missense variant moderate contig883 269965

IGV: Start, Jump



c.590A>T p.Lys197Ile missense variant moderate contig883 270079

IGV: Start, Jump



c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump



c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump



c.198A>C p.Lys66Asn missense variant moderate contig121 2828854

IGV: Start, Jump



c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump



c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump



c.517A>T p.Ile173Leu missense variant & splice region variant moderate contig121 2830795

IGV: Start, Jump



c.757G>T p.Val253Leu missense variant moderate contig121 2831364

IGV: Start, Jump



c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump



c.2981T>C p.Met994Thr missense variant moderate contig1450 2044012

IGV: Start, Jump



c.2964C>A p.Asp988Glu missense variant moderate contig1450 2044029

IGV: Start, Jump



c.2929T>C p.Phe977Leu missense variant moderate contig1450 2044103

IGV: Start, Jump



c.2869C>T p.His957Tyr missense variant moderate contig1450 2044163

IGV: Start, Jump



c.2831A>G p.Glu944Gly missense variant moderate contig1450 2044201

IGV: Start, Jump



c.125G>A p.Ser42Asn missense variant moderate contig1450 2047909

IGV: Start, Jump



c.709C>G p.Leu237Val missense variant moderate contig1357 1145222

IGV: Start, Jump



c.722G>A p.Arg241Lys missense variant moderate contig976 1083132

IGV: Start, Jump



c.659G>A p.Arg220Gln missense variant moderate contig976 1083195

IGV: Start, Jump



c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump



c.586-28_608delGACACCTTGTGCGTTCATTAATGTGAAGAGTGATGCTAATGTCAGTGGTGA p.Ser196fs frameshift variant & splice acceptor variant & splice region variant & intron variant high contig976 1083245

IGV: Start, Jump



c.338_339delCT p.Pro113fs frameshift variant high contig976 1083685

IGV: Start, Jump



c.296C>T p.Pro99Leu missense variant moderate contig976 1083729

IGV: Start, Jump



c.199A>G p.Asn67Asp missense variant moderate contig976 1083876

IGV: Start, Jump



c.188A>G p.Asn63Ser missense variant moderate contig976 1083887

IGV: Start, Jump



c.3G>A p.Met1? start lost high contig976 1084072

IGV: Start, Jump



c.*320_*342+3delTCTCTCTCTCTCTCTCTCTCTATATA splice donor variant & splice region variant & 3 prime UTR variant & intron variant high contig510 71447

IGV: Start, Jump



c.*328_*342+3delTCTCTCTCTCTCTATATA splice donor variant & splice region variant & 3 prime UTR variant & intron variant high contig510 71455

IGV: Start, Jump



c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump



c.3038G>A p.Arg1013His missense variant moderate contig1225 2284653

IGV: Start, Jump



c.248G>T p.Arg83Met missense variant moderate contig2282 549240

IGV: Start, Jump



c.376G>C p.Glu126Gln missense variant moderate contig2282 549368

IGV: Start, Jump



c.382C>T p.Leu128Phe missense variant moderate contig2282 549374

IGV: Start, Jump



c.456T>A p.His152Gln missense variant moderate contig2282 549448

IGV: Start, Jump



c.460G>A p.Asp154Asn missense variant moderate contig2282 549452

IGV: Start, Jump



c.620A>G p.Lys207Arg missense variant moderate contig2282 549612

IGV: Start, Jump



c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump



c.64A>C p.Ser22Arg missense variant moderate contig93 3333355

IGV: Start, Jump


Nearest genetic relatives (All Samples)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.203 Lift (RSP11378)
  2. 0.208 VIR 483 (SRR14708239)
  3. 0.219 XUM1 (SRR14708205)
  4. 0.228 Fedora 17 (SRR14708222)
  5. 0.229 Serious Happiness (RSP10763)
  6. 0.238 XUM2 (SRR14708204)
  7. 0.240 R1in136 (SRR14708237)
  8. 0.243 Suver Haze (RSP11364)
  9. 0.244 QHI (SRR14708202)
  10. 0.245 Electra (RSP11366)
  11. 0.247 Rest (RSP11377)
  12. 0.248 AOAC MI 567 (RSP11758)
  13. 0.248 Badger (RSP11614)
  14. 0.248 XHC1 (SRR14708212)
  15. 0.250 Carmagnola (SRR14708200)
  16. 0.252 JL x NSPM1 3 (RSP11481)
  17. 0.252 AOAC MI 597 (RSP11761)
  18. 0.253 AOAC MI 533 (RSP11753)
  19. 0.253 Liberty Haze (RSP11000)
  20. 0.255 R1in136 (SRR14708225)

Nearest genetic relatives (Base Tree)

0 0.083 0.167 0.250 0.333
clone distance sibling distance more distant
  1. 0.253 Tisza (RSP11044)
  2. 0.257 USO 31 (RSP10981)
  3. 0.258 Kyrgyz Gold (RSP11054)
  4. 0.268 KYRG-11 (RSP11051)
  5. 0.269 UP Sunrise (RSP10989)
  6. 0.273 Liberty Haze (RSP11000)
  7. 0.276 Tygra (RSP10667)
  8. 0.278 Futura 75 (RSP10664)
  9. 0.286 RKM-2018-029 (RSP11121)
  10. 0.288 Feral (RSP10890)
  11. 0.293 Cherry (RSP11142)
  12. 0.297 Monoica (RSP10241)
  13. 0.298 Fedora 17 (RSP10661)
  14. 0.299 Lovrin (RSP10658)
  15. 0.303 Cherry (RSP11143)
  16. 0.305 Kimbo Slice (RSP10997)
  17. 0.305 Italian Kiss (RSP11034)
  18. 0.309 Hermaphrodite Research Sample1 (RSP11049)
  19. 0.311 Blue Dream (RSP11033)
  20. 0.316 Hermaphrodite ResearchSample2 (RSP11050)

Most genetically distant strains (All Samples)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.471 80E (RSP11213)
  2. 0.443 Danny Noonan (RSP11070)
  3. 0.438 JL yellow (RSP11075)
  4. 0.418 JL 2 (RSP11076)
  5. 0.414 Purple Strawberry AK47 1 1 (RSP11415)
  6. 0.413 Tanao Sri-white 80 (RSP11621)
  7. 0.411 Blueberry Cheesecake (RSP10671)
  8. 0.411 Blueberry Cheesecake (RSP10672)
  9. 0.408 Cbot-2019-005 (RSP11133)
  10. 0.408 Durban Poison (RSP11014)
  11. 0.405 JL 4th Gen 1 (RSP11193)
  12. 0.405 Blueberry Cheesecake (RSP10670)
  13. 0.402 UP Sunset (RSP11256)
  14. 0.402 Chematonic Cannatonic x Chemdawg (RSP11394)
  15. 0.401 RKM-2018-006 (RSP11097)
  16. 0.400 JL 3rd Gen Mother (RSP11197)
  17. 0.399 UP Royale (RSP11257)
  18. 0.399 White Label 1 (RSP11336)
  19. 0.397 80E (RSP11211)
  20. 0.397 80E (RSP11212)

Most genetically distant strains (Base Tree)

0 0.108 0.217 0.325 0.433
clone distance sibling distance more distant
  1. 0.424 JL yellow (RSP11075)
  2. 0.414 Kush Hemp E1 (RSP11128)
  3. 0.402 Cbot-2019-005 (RSP11133)
  4. 0.396 The Gift (RSP10988)
  5. 0.396 Cbot-2019-004 (RSP11132)
  6. 0.396 Durban Poison (RSP11014)
  7. 0.389 RKM-2018-006 (RSP11097)
  8. 0.387 RKM-2018-002 (RSP11093)
  9. 0.382 Cbot-2019-006 (RSP11134)
  10. 0.381 Blueberry Cheesecake (RSP10672)
  11. 0.380 Skywalker OG (RSP10837)
  12. 0.379 Blueberry Cheesecake (RSP10680)
  13. 0.374 Cbot-2019-001 (RSP11129)
  14. 0.371 Pie Hoe (RSP11073)
  15. 0.368 RKM-2018-005 (RSP11096)
  16. 0.365 Ivory (RSP10668)
  17. 0.364 QUEEN JESUS (RSP10105)
  18. 0.362 RKM-2018-022 (RSP11114)
  19. 0.361 RKM-2018-028 (RSP11120)
  20. 0.359 RKM-2018-032 (RSP11124)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4448770
Overlapping SNPs:

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495167
Overlapping SNPs:
QR code for SRR14708209

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings