Colombian 8

SRR 14708214

Grower: Lanzhou University, Guangpeng Ren

General Information

Sample Name
Accession Date
May 31, 2021
Reported Plant Sex
not reported

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Common
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.


No information provided.


No information provided.

Genetic Information

Plant Type
Type I

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 0.85%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0166
male female SRR14708214

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
THCAS c.749C>A p.Ala250Asp missense variant moderate contig741 4417079

IGV: Start, Jump


Variants (Select Genes of Interest)



c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

PHL-2 c.2624C>T p.Ser875Phe missense variant moderate contig2621 342667

IGV: Start, Jump

PHL-2 c.2933G>T p.Arg978Leu missense variant moderate contig2621 342976

IGV: Start, Jump

PHL-2 c.2936T>G p.Val979Gly missense variant moderate contig2621 342979

IGV: Start, Jump

PHL-2 c.3467A>G p.Gln1156Arg missense variant moderate contig2621 343510

IGV: Start, Jump



c.520A>C p.Asn174His missense variant moderate contig97 242226

IGV: Start, Jump



c.1230-2_1230-1delAG splice acceptor variant & intron variant high contig97 243676

IGV: Start, Jump



c.1803_1805delTCA p.His601del disruptive inframe deletion moderate contig97 244625

IGV: Start, Jump



c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump



c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump



c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump



c.1415G>A p.Ser472Asn missense variant moderate contig81 210377

IGV: Start, Jump



c.1417A>G p.Thr473Ala missense variant moderate contig81 210379

IGV: Start, Jump



c.1434G>T p.Glu478Asp missense variant moderate contig81 210396

IGV: Start, Jump



c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump



c.1381G>A p.Asp461Asn missense variant moderate contig1891 886367

IGV: Start, Jump



c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump



c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump



c.216A>T p.Lys72Asn missense variant moderate contig121 2828872

IGV: Start, Jump



c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump



c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump



c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump



c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump



c.2981T>C p.Met994Thr missense variant moderate contig1450 2044012

IGV: Start, Jump



c.2964C>A p.Asp988Glu missense variant moderate contig1450 2044029

IGV: Start, Jump



c.2929T>C p.Phe977Leu missense variant moderate contig1450 2044103

IGV: Start, Jump



c.125G>A p.Ser42Asn missense variant moderate contig1450 2047909

IGV: Start, Jump



c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump



c.466A>C p.Met156Leu missense variant moderate contig976 1083559

IGV: Start, Jump



c.389_431delGCATTGAGGAACTAGATGTGAAAGATCTTGTGACACTGAAGAG p.Gly130fs frameshift variant high contig976 1083593

IGV: Start, Jump



c.274G>A p.Gly92Ser missense variant moderate contig976 1083751

IGV: Start, Jump



c.14C>T p.Ala5Val missense variant moderate contig976 1084061

IGV: Start, Jump



c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump


Nearest genetic relatives (All Samples)

0 0.033 0.067 0.100 0.133
clone distance sibling distance more distant
  1. 0.106 AOAC MI 535 (RSP11754)
  2. 0.106 Blue Dream (RSP11010)
  3. 0.109 Blue Dream (RSP11006)
  4. 0.109 AOAC MI 599 (RSP11762)
  5. 0.112 AOAC MI 504 (RSP11749)
  6. 0.117 AOAC MI 533 (RSP11753)
  7. 0.117 B52 (SRR14708255)
  8. 0.117 AOAC MI 597 (RSP11761)
  9. 0.119 Blue Dream (RSP11007)
  10. 0.122 UP Sunrise (RSP10989)
  11. 0.122 Blue Dream (RSP11017)
  12. 0.125 Super Blue Dream (RSP11011)
  13. 0.125 AOAC MI 501 (RSP11748)
  14. 0.125 AOAC MI 567 (RSP11758)
  15. 0.126 Doug s Varin (RSP11243)
  16. 0.128 AOAC MI 532 (RSP11752)
  17. 0.128 AOAC MI 545 (RSP11756)
  18. 0.129 Blue Dream (RSP11009)
  19. 0.129 AOAC MI 542 (RSP11755)
  20. 0.131 Blue Dream (RSP11004)

Nearest genetic relatives (Base Tree)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.128 UP Sunrise (RSP10989)
  2. 0.148 Italian Kiss (RSP11034)
  3. 0.165 Gold Cracker (RSP11048)
  4. 0.172 RKM-2018-009 (RSP11100)
  5. 0.181 Blue Dream (RSP11033)
  6. 0.181 Liberty Haze (RSP11000)
  7. 0.185 RKM-2018-027 (RSP11119)
  8. 0.197 QUEEN JESUS (RSP10105)
  9. 0.207 Hermaphrodite Research Sample1 (RSP11049)
  10. 0.208 Hermaphrodite ResearchSample2 (RSP11050)
  11. 0.211 Blueberry Cheesecake (RSP10684)
  12. 0.213 Durban Poison (RSP11014)
  13. 0.215 Sour Raspberry (RSP10551)
  14. 0.222 CST (RSP11002)
  15. 0.223 RKM-2018-028 (RSP11120)
  16. 0.223 Cherry (RSP11143)
  17. 0.233 RKM-2018-003 (RSP11094)
  18. 0.237 RKM-2018-005 (RSP11096)
  19. 0.238 Jiangji (RSP10653)
  20. 0.238 RKM-2018-006 (RSP11097)

Most genetically distant strains (All Samples)

0 0.108 0.217 0.325 0.433
clone distance sibling distance more distant
  1. 0.414 CS (RSP11208)
  2. 0.390 JL 4th Gen 5 (RSP11199)
  3. 0.388 Feral (RSP11205)
  4. 0.378 JL 4th Gen 1 (RSP11193)
  5. 0.369 Red Eye OG (RSP11190)
  6. 0.368 JL 3rd Gen Father (RSP11196)
  7. 0.367 Tiborszallasie (RSP11210)
  8. 0.366 IUP3 (SRR14708256)
  9. 0.365 JL 4th Gen 6 (RSP11200)
  10. 0.362 Feral (RSP11206)
  11. 0.362 Skywalker OG (RSP10837)
  12. 0.359 Beniko (SRR14708275)
  13. 0.357 JL yellow (RSP11075)
  14. 0.356 Santhica27 (RSP11046)
  15. 0.355 JL 2 (RSP11076)
  16. 0.353 Ivory (RSP10668)
  17. 0.353 YMCM (RSP11416)
  18. 0.352 Carmaleonte (RSP11207)
  19. 0.352 JL 4th Gen 2 (RSP11194)
  20. 0.351 80E (RSP11213)

Most genetically distant strains (Base Tree)

0 0.092 0.183 0.275 0.367
clone distance sibling distance more distant
  1. 0.355 RKM-2018-026 (RSP11118)
  2. 0.352 Skywalker OG (RSP10837)
  3. 0.345 JL yellow (RSP11075)
  4. 0.342 Ivory (RSP10668)
  5. 0.339 Carmagnola (RSP10979)
  6. 0.339 Cbot-2019-005 (RSP11133)
  7. 0.338 Lovrin (RSP10658)
  8. 0.338 Santhica27 (RSP11047)
  9. 0.337 Fedora 17 (RSP10661)
  10. 0.335 Futura 75 (RSP10664)
  11. 0.322 RKM-2018-034 (RSP11126)
  12. 0.316 Kush Hemp E1 (RSP11128)
  13. 0.311 Skunk 18 (RSP11038)
  14. 0.309 Tisza (RSP11044)
  15. 0.306 Kyrgyz Gold (RSP11054)
  16. 0.305 Feral (RSP10890)
  17. 0.303 Tisza (RSP10659)
  18. 0.301 Carmagnola (RSP11037)
  19. 0.294 Blueberry Cheesecake (RSP10672)
  20. 0.289 RKM-2018-002 (RSP11093)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8348993
Overlapping SNPs:

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495178
Overlapping SNPs:
QR code for SRR14708214

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings