PID1

SRR 14708248

Grower: Lanzhou University, Guangpeng Ren

General Information

Accession Date
May 31, 2021
Reported Plant Sex
unknown

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Uncommon
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type II

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.3%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0214
male female SRR14708248

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

No variants to report

Variants (Select Genes of Interest)

GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
GPPs1

UniProt

c.896A>G p.Asn299Ser missense variant moderate contig676 169772

IGV: Start, Jump

A/G
NGS:
0.046
C90:
0.000
EMF1-2

UniProt

c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

A/C
NGS:
0.090
C90:
0.474
EMF1-2

UniProt

c.1187T>C p.Leu396Ser missense variant moderate contig885 2073

IGV: Start, Jump

T/C
NGS:
0.026
C90:
0.000
EMF1-2

UniProt

c.2256A>T p.Lys752Asn missense variant moderate contig885 3142

IGV: Start, Jump

A/T
NGS:
0.026
C90:
0.000
PHL-2 c.455A>C p.Asp152Ala missense variant moderate contig2621 339191

IGV: Start, Jump

A/C
NGS:
0.018
C90:
0.507
PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

A/G
NGS:
0.096
C90:
0.555
PHL-2 c.1438C>G p.Leu480Val missense variant moderate contig2621 340716

IGV: Start, Jump

C/G
NGS:
0.000
C90:
0.000
PHL-2 c.1450G>A p.Glu484Lys missense variant moderate contig2621 340728

IGV: Start, Jump

G/A
NGS:
0.000
C90:
0.000
PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

T/A
NGS:
0.064
C90:
0.732
PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.746
PHL-2 c.2582C>G p.Pro861Arg missense variant moderate contig2621 342625

IGV: Start, Jump

C/G
NGS:
0.002
C90:
0.000
PHL-2 c.3552delG p.Lys1185fs frameshift variant high contig2621 343593

IGV: Start, Jump

CG/C
NGS:
0.004
C90:
0.000
PHL-2 c.3556_3557delAA p.Lys1186fs frameshift variant high contig2621 343598

IGV: Start, Jump

GAA/G
NGS:
0.013
C90:
0.096
PKSG-4b

UniProt

c.353_354insCC p.Gly119fs frameshift variant high contig700 2721319

IGV: Start, Jump

T/TGG
NGS:
0.175
C90:
0.000
PKSG-4b

UniProt

c.273-2A>T splice acceptor variant & intron variant high contig700 2723865

IGV: Start, Jump

T/A
NGS:
0.000
C90:
0.000
PKSG-4a

UniProt

c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump

AATT/A
NGS:
0.167
C90:
0.000
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.-22_2delTAAAAATTATAATAATAATAATAT p.Met1del start lost & conservative inframe deletion high contig700 1945631

IGV: Start, Jump

CATATTATTATTATTATAATTTTTA/C
NGS:
0.013
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
OAC-2

UniProt

c.22G>A p.Val8Ile missense variant moderate contig931 110317

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.000
FAD2-2

UniProt

c.54T>A p.His18Gln missense variant moderate contig83 1803315

IGV: Start, Jump

A/T
NGS:
0.000
C90:
0.000
ELF3

UniProt

c.520A>C p.Asn174His missense variant moderate contig97 242226

IGV: Start, Jump

A/C
NGS:
0.094
C90:
0.502
ELF3

UniProt

c.574A>G p.Asn192Asp missense variant moderate contig97 242280

IGV: Start, Jump

A/G
NGS:
0.042
C90:
0.579
ELF3

UniProt

c.1230-2_1230-1delAG splice acceptor variant & intron variant high contig97 243676

IGV: Start, Jump

TAG/T
NGS:
0.088
C90:
0.450
ELF3

UniProt

c.1385C>T p.Ala462Val missense variant moderate contig97 244216

IGV: Start, Jump

C/T
NGS:
0.004
C90:
0.000
ELF3

UniProt

c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump

G/A
NGS:
0.123
C90:
0.000
ELF3

UniProt

c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.545
aPT1

UniProt

c.160A>C p.Thr54Pro missense variant moderate contig121 2835867

IGV: Start, Jump

A/C
NGS:
0.086
C90:
0.048
aPT1

UniProt

c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump

A/G
NGS:
0.579
C90:
0.761
aPT1

UniProt

c.670T>A p.Ser224Thr missense variant moderate contig121 2840278

IGV: Start, Jump

T/A
NGS:
0.077
C90:
0.000
aPT1

UniProt

c.727G>T p.Glu243* stop gained high contig121 2841362

IGV: Start, Jump

G/T
NGS:
0.127
C90:
0.100
aPT1

UniProt

c.958G>A p.Gly320Ser missense variant moderate contig121 2842731

IGV: Start, Jump

G/A
NGS:
0.004
C90:
0.000
AAE1-2

UniProt

c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump

A/G
NGS:
0.123
C90:
0.000
AAE1-2

UniProt

c.374A>G p.His125Arg missense variant moderate contig81 209336

IGV: Start, Jump

A/G
NGS:
0.026
C90:
0.000
AAE1-2

UniProt

c.947_948insTAGA p.Asp317fs frameshift variant high contig81 209908

IGV: Start, Jump

C/CATAG
NGS:
0.004
C90:
0.000
AAE1-2

UniProt

c.950_954delACCAA p.Asp317fs frameshift variant high contig81 209911

IGV: Start, Jump

GACCAA/G
NGS:
0.004
C90:
0.000
AAE1-2

UniProt

c.955_956insT p.Arg319fs frameshift variant high contig81 209917

IGV: Start, Jump

C/CT
NGS:
0.004
C90:
0.000
AAE1-2

UniProt

c.1102C>A p.His368Asn missense variant moderate contig81 210064

IGV: Start, Jump

C/A
NGS:
0.033
C90:
0.000
AAE1-2

UniProt

c.1115A>G p.Glu372Gly missense variant moderate contig81 210077

IGV: Start, Jump

A/G
NGS:
0.004
C90:
0.000
AAE1-2

UniProt

c.1415G>A p.Ser472Asn missense variant moderate contig81 210377

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1417A>G p.Thr473Ala missense variant moderate contig81 210379

IGV: Start, Jump

A/G
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1434G>T p.Glu478Asp missense variant moderate contig81 210396

IGV: Start, Jump

G/T
NGS:
0.075
C90:
0.000
PHL-1

UniProt

c.99G>T p.Glu33Asp missense variant moderate contig1439 1493793

IGV: Start, Jump

C/A
NGS:
0.000
C90:
0.000
HDS-1

UniProt

c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump

C/T
NGS:
0.167
C90:
0.000
HDS-1

UniProt

c.35G>A p.Cys12Tyr missense variant moderate contig1891 889357

IGV: Start, Jump

C/T
NGS:
0.094
C90:
0.646
PIE1-2

UniProt

c.6773T>C p.Leu2258Ser missense variant moderate contig1460 1184314

IGV: Start, Jump

A/G
NGS:
0.046
C90:
0.675
PIE1-2

UniProt

c.6307A>C p.Lys2103Gln missense variant moderate contig1460 1185177

IGV: Start, Jump

T/G
NGS:
0.004
C90:
0.679
PIE1-2

UniProt

c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump

T/C
NGS:
0.061
C90:
0.268
EMF1-1

UniProt

c.242A>G p.Lys81Arg missense variant moderate contig883 269731

IGV: Start, Jump

A/G
NGS:
0.022
C90:
0.053
FT

UniProt

c.419G>A p.Ser140Asn missense variant moderate contig1561 3126658

IGV: Start, Jump

G/A
NGS:
0.013
C90:
0.033
FT

UniProt

c.440A>C p.Ter147Serext*? stop lost & splice region variant high contig1561 3126679

IGV: Start, Jump

A/C
NGS:
0.013
C90:
0.038
aPT4

UniProt

c.80A>G p.Lys27Arg missense variant moderate contig121 2828736

IGV: Start, Jump

A/G
NGS:
0.061
C90:
0.000
aPT4

UniProt

c.202T>A p.Leu68Ile missense variant moderate contig121 2828858

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
aPT4

UniProt

c.916C>T p.His306Tyr missense variant & splice region variant moderate contig121 2832711

IGV: Start, Jump

C/T
NGS:
0.015
C90:
0.000
AAE1-3

UniProt

c.467T>C p.Met156Thr missense variant moderate contig976 1083558

IGV: Start, Jump

A/G
NGS:
0.002
C90:
0.000
AAE1-3

UniProt

c.167A>G p.Glu56Gly missense variant moderate contig976 1083908

IGV: Start, Jump

T/C
NGS:
0.070
C90:
0.000
AAE1-3

UniProt

c.141A>G p.Ile47Met missense variant moderate contig976 1083934

IGV: Start, Jump

T/C
NGS:
0.004
C90:
0.000
AAE1-3

UniProt

c.125A>G p.Glu42Gly missense variant moderate contig976 1083950

IGV: Start, Jump

T/C
NGS:
0.064
C90:
0.000
FAD7A-1

UniProt

c.*342+1A>C splice donor variant & intron variant high contig510 71471

IGV: Start, Jump

A/C
NGS:
0.004
C90:
0.000
PKSB-3

UniProt

c.64A>C p.Ser22Arg missense variant moderate contig93 3333355

IGV: Start, Jump

A/C
NGS:
0.000
C90:
0.000
PKSB-3

UniProt

c.1960G>C p.Glu654Gln missense variant moderate contig93 3340067

IGV: Start, Jump

G/C
NGS:
0.000
C90:
0.000
PKSB-3

UniProt

c.1978A>G p.Asn660Asp missense variant moderate contig93 3340085

IGV: Start, Jump

A/G
NGS:
0.000
C90:
0.000

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4450097
Overlapping SNPs:
12
Concordance:
10

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495207
Overlapping SNPs:
5
Concordance:
5
QR code for SRR14708248

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings