SRR 14708258

Grower: Lanzhou University, Guangpeng Ren

General Information

Accession Date
May 31, 2021
Reported Plant Sex
not reported

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.


No information provided.


No information provided.

Genetic Information

Plant Type
Type I

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.2%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0227
male female SRR14708258

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

No variants to report

Variants (Select Genes of Interest)



c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump



c.885G>A p.Met295Ile missense variant & splice region variant moderate contig676 169675

IGV: Start, Jump



c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

PHL-2 c.932T>C p.Leu311Pro missense variant moderate contig2621 340210

IGV: Start, Jump

PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

PHL-2 c.1096G>A p.Ala366Thr missense variant moderate contig2621 340374

IGV: Start, Jump

PHL-2 c.1364A>G p.Asp455Gly missense variant moderate contig2621 340642

IGV: Start, Jump

PHL-2 c.1381T>G p.Phe461Val missense variant moderate contig2621 340659

IGV: Start, Jump

PHL-2 c.1438C>G p.Leu480Val missense variant moderate contig2621 340716

IGV: Start, Jump

PHL-2 c.1450G>A p.Glu484Lys missense variant moderate contig2621 340728

IGV: Start, Jump

PHL-2 c.1493G>A p.Gly498Asp missense variant moderate contig2621 340771

IGV: Start, Jump

PHL-2 c.2582C>G p.Pro861Arg missense variant moderate contig2621 342625

IGV: Start, Jump

PHL-2 c.2834A>G p.Asn945Ser missense variant moderate contig2621 342877

IGV: Start, Jump

PHL-2 c.3020T>A p.Ile1007Asn missense variant moderate contig2621 343063

IGV: Start, Jump

PHL-2 c.3373A>G p.Thr1125Ala missense variant moderate contig2621 343416

IGV: Start, Jump

PHL-2 c.3556_3557delAA p.Lys1186fs frameshift variant high contig2621 343598

IGV: Start, Jump



c.535_545delATTGGAGTGGG p.Ile179fs frameshift variant high contig700 2721127

IGV: Start, Jump



c.523C>T p.His175Tyr missense variant moderate contig700 2721150

IGV: Start, Jump



c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump



c.353_354insCC p.Gly119fs frameshift variant high contig700 2721319

IGV: Start, Jump



c.316+2T>A splice donor variant & intron variant high contig700 2723818

IGV: Start, Jump



c.229G>A p.Gly77Ser missense variant moderate contig700 2724206

IGV: Start, Jump



c.216G>C p.Leu72Phe missense variant moderate contig700 2724219

IGV: Start, Jump



c.206T>C p.Leu69Ser missense variant moderate contig700 2724229

IGV: Start, Jump



c.493G>A p.Gly165Ser missense variant moderate contig700 1937904

IGV: Start, Jump



c.1191_1193delTTA p.Tyr398del disruptive inframe deletion moderate contig700 1938600

IGV: Start, Jump



c.948T>G p.Asp316Glu missense variant moderate contig700 1944442

IGV: Start, Jump



c.945T>G p.Ser315Arg missense variant moderate contig700 1944445

IGV: Start, Jump



c.944G>A p.Ser315Asn missense variant moderate contig700 1944446

IGV: Start, Jump



c.934C>G p.His312Asp missense variant moderate contig700 1944456

IGV: Start, Jump



c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump



c.574A>G p.Asn192Asp missense variant moderate contig97 242280

IGV: Start, Jump



c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump



c.1487T>C p.Val496Ala missense variant moderate contig382 881925

IGV: Start, Jump



c.220A>G p.Ile74Val missense variant moderate contig121 2835927

IGV: Start, Jump



c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump



c.374A>G p.His125Arg missense variant moderate contig81 209336

IGV: Start, Jump



c.948_949insA p.Asp317fs frameshift variant high contig81 209910

IGV: Start, Jump



c.952delC p.Gln318fs frameshift variant high contig81 209912

IGV: Start, Jump



c.953A>G p.Gln318Arg missense variant moderate contig81 209915

IGV: Start, Jump



c.955C>T p.Arg319Cys missense variant moderate contig81 209917

IGV: Start, Jump



c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump



c.1102C>A p.His368Asn missense variant moderate contig81 210064

IGV: Start, Jump



c.1115A>G p.Glu372Gly missense variant moderate contig81 210077

IGV: Start, Jump



c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump



c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump



c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump



c.176G>A p.Gly59Glu missense variant moderate contig1439 1492817

IGV: Start, Jump



c.175G>A p.Gly59Arg missense variant moderate contig1439 1492818

IGV: Start, Jump



c.230A>G p.Glu77Gly missense variant moderate contig850 3065060

IGV: Start, Jump



c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump



c.-2_1delATA p.Met1del start lost & conservative inframe deletion high contig700 1951880

IGV: Start, Jump



c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump



c.1381G>A p.Asp461Asn missense variant moderate contig1891 886367

IGV: Start, Jump



c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump



c.136G>A p.Val46Ile missense variant moderate contig1891 889256

IGV: Start, Jump



c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump



c.35G>A p.Cys12Tyr missense variant moderate contig1891 889357

IGV: Start, Jump



c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump



c.6653A>G p.Asn2218Ser missense variant moderate contig1460 1184434

IGV: Start, Jump



c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump



c.902-2A>T splice acceptor variant & intron variant high contig1460 1192498

IGV: Start, Jump



c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump



c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump



c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump



c.198A>C p.Lys66Asn missense variant moderate contig121 2828854

IGV: Start, Jump



c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump



c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump



c.2981T>C p.Met994Thr missense variant moderate contig1450 2044012

IGV: Start, Jump



c.2964C>A p.Asp988Glu missense variant moderate contig1450 2044029

IGV: Start, Jump



c.2686G>A p.Ala896Thr missense variant moderate contig1450 2044848

IGV: Start, Jump



c.2681T>C p.Ile894Thr missense variant moderate contig1450 2044853

IGV: Start, Jump



c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump



c.610delG p.Glu204fs frameshift variant high contig976 1083243

IGV: Start, Jump



c.600_608delCAGTGGTGA p.Ser201_Asp203del disruptive inframe deletion moderate contig976 1083245

IGV: Start, Jump



c.382T>C p.Tyr128His missense variant moderate contig976 1083643

IGV: Start, Jump



c.293A>G p.Asp98Gly missense variant moderate contig976 1083732

IGV: Start, Jump



c.260T>C p.Val87Ala missense variant moderate contig976 1083765

IGV: Start, Jump



c.125A>G p.Glu42Gly missense variant moderate contig976 1083950

IGV: Start, Jump



c.79A>G p.Thr27Ala missense variant moderate contig976 1083996

IGV: Start, Jump



c.52G>A p.Gly18Ser missense variant moderate contig976 1084023

IGV: Start, Jump



c.8C>T p.Ser3Leu missense variant moderate contig976 1084067

IGV: Start, Jump



c.*340_*343-4delTATATATATATATATATAGATA splice donor variant & splice region variant & 3 prime UTR variant & intron variant high contig510 71467

IGV: Start, Jump



c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump



c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump



c.1652A>G p.Glu551Gly missense variant moderate contig93 3339759

IGV: Start, Jump


Nearest genetic relatives (All Samples)

0 0.075 0.150 0.225 0.300
clone distance sibling distance more distant
  1. 0.143 IUP2 (SRR14708257)
  2. 0.146 IUP3 (SRR14708256)
  3. 0.218 Lift (RSP11378)
  4. 0.219 IBR1 (SRR14708251)
  5. 0.225 Blue Dream (RSP11004)
  6. 0.231 IBR3 (SRR14708249)
  7. 0.233 IBR2 (SRR14708250)
  8. 0.239 KYRG-151 (RSP11052)
  9. 0.240 PCL1 (SRR14708246)
  10. 0.247 Rest (RSP11377)
  11. 0.250 Durban Poison 1 (RSP11013)
  12. 0.252 Electra (RSP11366)
  13. 0.253 IBE (SRR14708228)
  14. 0.256 Haze (SRR14708264)
  15. 0.261 VIR 483 (SRR14708238)
  16. 0.261 PID1 (SRR14708248)
  17. 0.266 XGL2 (SRR14708208)
  18. 0.268 Suver Haze (RSP11364)
  19. 0.269 B52 (SRR14708255)
  20. 0.270 Calm (RSP11379)

Nearest genetic relatives (Base Tree)

0 0.092 0.183 0.275 0.367
clone distance sibling distance more distant
  1. 0.303 Hermaphrodite ResearchSample2 (RSP11050)
  2. 0.308 Golden Goat 2 (RSP10991)
  3. 0.311 Tisza (RSP10659)
  4. 0.314 Fedora 17 (RSP10661)
  5. 0.314 Jiangji (RSP10653)
  6. 0.317 Cherry (RSP11142)
  7. 0.327 RKM-2018-029 (RSP11121)
  8. 0.329 Recon (RSP10755)
  9. 0.338 Liberty Haze (RSP11000)
  10. 0.342 Carmagnola (RSP11037)
  11. 0.343 Lovrin (RSP10658)
  12. 0.345 QUEEN JESUS (RSP10105)
  13. 0.346 KYRG-11 (RSP11051)
  14. 0.346 Carmagnola (RSP10979)
  15. 0.352 RKM-2018-031 (RSP11123)
  16. 0.353 Blueberry Cheesecake (RSP10684)
  17. 0.355 Kyrgyz Gold (RSP11054)
  18. 0.358 Sour Raspberry (RSP10551)
  19. 0.360 CST (RSP11002)
  20. 0.361 Gold Cracker (RSP11048)

Most genetically distant strains (All Samples)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.470 Chem 91 (RSP11185)
  2. 0.453 Feral (RSP11206)
  3. 0.432 RKM-2018-002 (RSP11093)
  4. 0.432 CS (RSP11208)
  5. 0.429 UP Sunset (RSP11256)
  6. 0.424 JL 2 (RSP11076)
  7. 0.420 Red Eye OG (RSP11190)
  8. 0.419 RKM-2018-004 (RSP11095)
  9. 0.419 East Coast Sour Diesel (RSP10243)
  10. 0.418 Danny Noonan (RSP11070)
  11. 0.417 Super Sour Diesel (RSP11191)
  12. 0.417 JL yellow (RSP11075)
  13. 0.414 RKM-2018-026 (RSP11118)
  14. 0.408 GG4 (RSP11978)
  15. 0.408 JL 4th Gen 1 (RSP11193)
  16. 0.406 JL 3rd Gen Mother (RSP11214)
  17. 0.406 80E (RSP11213)
  18. 0.405 Dog Patch (RSP11725)
  19. 0.403 RKM-2018-012 (RSP11103)
  20. 0.401 Blueberry Cheesecake (RSP10672)

Most genetically distant strains (Base Tree)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.454 JL yellow (RSP11075)
  2. 0.435 RKM-2018-026 (RSP11118)
  3. 0.421 RKM-2018-002 (RSP11093)
  4. 0.411 Monoica (RSP10241)
  5. 0.410 Italian Kiss (RSP11034)
  6. 0.405 Blue Dream (RSP11033)
  7. 0.401 Cbot-2019-004 (RSP11132)
  8. 0.400 Blueberry Cheesecake (RSP10672)
  9. 0.399 RKM-2018-023 (RSP11115)
  10. 0.399 RKM-2018-005 (RSP11096)
  11. 0.398 Cbot-2019-006 (RSP11134)
  12. 0.397 USO 31 (RSP10981)
  13. 0.397 RKM-2018-034 (RSP11126)
  14. 0.395 Pie Hoe (RSP11073)
  15. 0.391 RKM-2018-032 (RSP11124)
  16. 0.390 Cbot-2019-005 (RSP11133)
  17. 0.385 RKM-2018-027 (RSP11119)
  18. 0.385 Futura 75 (RSP10664)
  19. 0.385 RKM-2018-009 (RSP11100)
  20. 0.384 RKM-2018-020 (RSP11112)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8349161
Overlapping SNPs:

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495171
Overlapping SNPs:
QR code for SRR14708258

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings