Tiborszallasi

SRR 14708273

Grower: Lanzhou University, Guangpeng Ren

General Information

Sample Name
HTI
Accession Date
May 31, 2021
Reported Plant Sex
unknown

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Uncommon
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.33%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0202
male female SRR14708273

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.8G>A p.Cys3Tyr missense variant moderate contig1772 2082234

IGV: Start, Jump

G/A
NGS:
0.057
C90:
0.000
CBDAS c.221C>G p.Thr74Ser missense variant moderate contig1772 2082447

IGV: Start, Jump

C/G
NGS:
0.136
C90:
0.057
CBDAS c.587A>G p.Asn196Ser missense variant moderate contig1772 2082813

IGV: Start, Jump

A/G
NGS:
0.011
C90:
0.435
CBDAS c.1628G>A p.Arg543His missense variant moderate contig1772 2083854

IGV: Start, Jump

G/A
NGS:
0.033
C90:
0.000

Variants (Select Genes of Interest)

GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
GPPs1

UniProt

c.896A>G p.Asn299Ser missense variant moderate contig676 169772

IGV: Start, Jump

A/G
NGS:
0.046
C90:
0.000
EMF1-2

UniProt

c.1187T>C p.Leu396Ser missense variant moderate contig885 2073

IGV: Start, Jump

T/C
NGS:
0.026
C90:
0.000
EMF1-2

UniProt

c.2256A>T p.Lys752Asn missense variant moderate contig885 3142

IGV: Start, Jump

A/T
NGS:
0.026
C90:
0.000
PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

A/G
NGS:
0.096
C90:
0.555
PHL-2 c.2830A>G p.Asn944Asp missense variant moderate contig2621 342873

IGV: Start, Jump

A/G
NGS:
0.018
C90:
0.000
PHL-2 c.3002A>G p.Tyr1001Cys missense variant moderate contig2621 343045

IGV: Start, Jump

A/G
NGS:
0.055
C90:
0.316
PKSG-4b

UniProt

c.557+2T>C splice donor variant & intron variant high contig700 2721114

IGV: Start, Jump

A/G
NGS:
0.011
C90:
0.000
PKSG-4b

UniProt

c.509_510insTAAGTTTTCC p.Glu172fs frameshift variant high contig700 2721163

IGV: Start, Jump

T/TGGAAAACTTA
NGS:
0.000
C90:
0.000
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
PKSG-4a

UniProt

c.493G>A p.Gly165Ser missense variant moderate contig700 1937904

IGV: Start, Jump

G/A
NGS:
0.103
C90:
0.000
PKSG-2a

UniProt

c.948T>G p.Asp316Glu missense variant moderate contig700 1944442

IGV: Start, Jump

A/C
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.945T>G p.Ser315Arg missense variant moderate contig700 1944445

IGV: Start, Jump

A/C
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.944G>A p.Ser315Asn missense variant moderate contig700 1944446

IGV: Start, Jump

C/T
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1944456

IGV: Start, Jump

G/C
NGS:
0.070
C90:
0.000
PKSG-2a

UniProt

c.-22_2delTAAAAATTATAATAATAATAATAT p.Met1del start lost & conservative inframe deletion high contig700 1945631

IGV: Start, Jump

CATATTATTATTATTATAATTTTTA/C
NGS:
0.013
C90:
0.000
DXR-2

UniProt

c.431C>G p.Ala144Gly missense variant moderate contig380 287760

IGV: Start, Jump

G/C
NGS:
0.182
C90:
0.550
ELF3

UniProt

c.1229+2T>C splice donor variant & intron variant high contig97 243389

IGV: Start, Jump

T/C
NGS:
0.011
C90:
0.000
ELF3

UniProt

c.2140C>T p.Pro714Ser missense variant moderate contig97 244971

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.038
ELF3

UniProt

c.2141C>G p.Pro714Arg missense variant moderate contig97 244972

IGV: Start, Jump

C/G
NGS:
0.088
C90:
0.335
HDS-2

UniProt

c.679G>C p.Gly227Arg missense variant moderate contig95 1990632

IGV: Start, Jump

G/C
NGS:
0.037
C90:
0.000
AAE1-2

UniProt

c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump

A/G
NGS:
0.123
C90:
0.000
AAE1-2

UniProt

c.374A>G p.His125Arg missense variant moderate contig81 209336

IGV: Start, Jump

A/G
NGS:
0.026
C90:
0.000
AAE1-2

UniProt

c.1415G>A p.Ser472Asn missense variant moderate contig81 210377

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1417A>G p.Thr473Ala missense variant moderate contig81 210379

IGV: Start, Jump

A/G
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1541T>C p.Val514Ala missense variant moderate contig81 210503

IGV: Start, Jump

T/C
NGS:
0.050
C90:
0.000
PKSG-2b

UniProt

c.1136G>A p.Arg379His missense variant moderate contig700 1950502

IGV: Start, Jump

C/T
NGS:
0.002
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
TFL1

UniProt

c.302-1G>A splice acceptor variant & intron variant high contig1636 520616

IGV: Start, Jump

C/T
NGS:
0.103
C90:
0.794
HDS-1

UniProt

c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump

C/T
NGS:
0.167
C90:
0.000
HDS-1

UniProt

c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump

G/C
NGS:
0.125
C90:
0.943
EMF2

UniProt

c.434C>T p.Ser145Phe missense variant moderate contig954 3049270

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.057
EMF2

UniProt

c.1183G>A p.Glu395Lys missense variant moderate contig954 3054195

IGV: Start, Jump

G/A
NGS:
0.009
C90:
0.000
EMF2

UniProt

c.1205C>T p.Ala402Val missense variant & splice region variant moderate contig954 3055694

IGV: Start, Jump

C/T
NGS:
0.015
C90:
0.053
EMF2

UniProt

c.1228A>G p.Ser410Gly missense variant moderate contig954 3055717

IGV: Start, Jump

A/G
NGS:
0.015
C90:
0.000
EMF2

UniProt

c.1315G>C p.Ala439Pro missense variant moderate contig954 3055804

IGV: Start, Jump

G/C
NGS:
0.015
C90:
0.053
EMF2

UniProt

c.1742C>G p.Thr581Ser missense variant moderate contig954 3059899

IGV: Start, Jump

C/G
NGS:
0.011
C90:
0.000
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
EMF1-1

UniProt

c.242A>G p.Lys81Arg missense variant moderate contig883 269731

IGV: Start, Jump

A/G
NGS:
0.022
C90:
0.053
FT

UniProt

c.196A>G p.Ile66Val missense variant moderate contig1561 3124620

IGV: Start, Jump

A/G
NGS:
0.004
C90:
0.033
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.198A>C p.Lys66Asn missense variant moderate contig121 2828854

IGV: Start, Jump

A/C
NGS:
0.044
C90:
0.000
aPT4

UniProt

c.634C>A p.Pro212Thr missense variant moderate contig121 2830912

IGV: Start, Jump

C/A
NGS:
0.009
C90:
0.000
aPT4

UniProt

c.757G>T p.Val253Leu missense variant moderate contig121 2831364

IGV: Start, Jump

G/T
NGS:
0.039
C90:
0.000
FLD

UniProt

c.2869C>T p.His957Tyr missense variant moderate contig1450 2044163

IGV: Start, Jump

G/A
NGS:
0.011
C90:
0.000
FLD

UniProt

c.2831A>G p.Glu944Gly missense variant moderate contig1450 2044201

IGV: Start, Jump

T/C
NGS:
0.011
C90:
0.000
AAE1-3

UniProt

c.224C>T p.Pro75Leu missense variant moderate contig976 1083851

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.208G>C p.Ala70Pro missense variant moderate contig976 1083867

IGV: Start, Jump

C/G
NGS:
0.007
C90:
0.000
AAE1-3

UniProt

c.199A>G p.Asn67Asp missense variant moderate contig976 1083876

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
AAE1-3

UniProt

c.188A>G p.Asn63Ser missense variant moderate contig976 1083887

IGV: Start, Jump

T/C
NGS:
0.077
C90:
0.000
AAE1-3

UniProt

c.167A>G p.Glu56Gly missense variant moderate contig976 1083908

IGV: Start, Jump

T/C
NGS:
0.070
C90:
0.000
GGR

UniProt

c.32C>A p.Thr11Lys missense variant moderate contig2282 549024

IGV: Start, Jump

C/A
NGS:
0.009
C90:
0.000
GGR

UniProt

c.232G>C p.Val78Leu missense variant moderate contig2282 549224

IGV: Start, Jump

G/C
NGS:
0.000
C90:
0.000
GGR

UniProt

c.317C>T p.Pro106Leu missense variant moderate contig2282 549309

IGV: Start, Jump

C/T
NGS:
0.035
C90:
0.220
GGR

UniProt

c.382C>T p.Leu128Phe missense variant moderate contig2282 549374

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.000
GGR

UniProt

c.541G>A p.Val181Ile missense variant moderate contig2282 549533

IGV: Start, Jump

G/A
NGS:
0.009
C90:
0.000
PKSB-3

UniProt

c.1848G>A p.Met616Ile missense variant moderate contig93 3339955

IGV: Start, Jump

G/A
NGS:
0.009
C90:
0.000

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8346932
Overlapping SNPs:
14
Concordance:
11

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495242
Overlapping SNPs:
2
Concordance:
2
QR code for SRR14708273

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings