Feral

RSP 11205

Grower: John McKay-Colorado State University

General Information

Sample Name
Merino_S_1_CSU
Accession Date
June 26, 2019
Reported Plant Sex
Male

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type III

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 2.45%
Least Heterozygous Most Heterozygous

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

CBDAS c.8G>A p.Cys3Tyr missense variant moderate contig1772 2082234

IGV: Start, Jump

G/A
NGS:
0.057
C90:
0.000
CBDAS c.1420A>C p.Lys474Gln missense variant moderate contig1772 2083646

IGV: Start, Jump

A/C
NGS:
0.132
C90:
0.813
CBDAS c.1628G>A p.Arg543His missense variant moderate contig1772 2083854

IGV: Start, Jump

G/A
NGS:
0.033
C90:
0.000

Variants (Select Genes of Interest)

PKSA-3b

UniProt

c.298G>A p.Ala100Thr missense variant moderate contig705 2271640

IGV: Start, Jump

C/T
NGS:
0.044
C90:
0.177
GPPs1

UniProt

c.160A>G p.Lys54Glu missense variant moderate contig676 168409

IGV: Start, Jump

A/G
NGS:
0.026
C90:
0.000
GPPs1

UniProt

c.472T>A p.Leu158Met missense variant moderate contig676 168721

IGV: Start, Jump

T/A
NGS:
0.020
C90:
0.000
GPPs1

UniProt

c.744C>G p.Asp248Glu missense variant moderate contig676 168993

IGV: Start, Jump

C/G
NGS:
0.022
C90:
0.000
GPPs1

UniProt

c.807_814delGCATTTTT p.His270fs frameshift variant high contig676 169595

IGV: Start, Jump

GTGCATTTT/G
NGS:
0.015
C90:
0.000
GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
GPPs1

UniProt

c.857_864delCGAAAGAG p.Ala286fs frameshift variant high contig676 169645

IGV: Start, Jump

GGCGAAAGA/G
NGS:
0.009
C90:
0.000
GPPs1

UniProt

c.866_877delTACTAGAGCTAG p.Leu289_Glu293delinsTer stop gained & disruptive inframe deletion high contig676 169655

IGV: Start, Jump

TTACTAGAGCTAG/T
NGS:
0.009
C90:
0.000
GPPs1

UniProt

c.896A>G p.Asn299Ser missense variant moderate contig676 169772

IGV: Start, Jump

A/G
NGS:
0.046
C90:
0.000
GPPs1

UniProt

c.923_927+5delTTTTGGTACT p.Val308fs frameshift variant & splice donor variant & splice region variant & intron variant high contig676 169798

IGV: Start, Jump

GTTTTGGTACT/G
NGS:
0.009
C90:
0.000
GPPs1

UniProt

c.931delT p.Ter311fs frameshift variant & stop lost & splice region variant high contig676 169840

IGV: Start, Jump

AT/A
NGS:
0.009
C90:
0.000
EMF1-2

UniProt

c.3G>T p.Met1? start lost high contig885 103

IGV: Start, Jump

G/T
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

A/C
NGS:
0.090
C90:
0.474
EMF1-2

UniProt

c.1148C>T p.Ala383Val missense variant moderate contig885 2034

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1187T>C p.Leu396Ser missense variant moderate contig885 2073

IGV: Start, Jump

T/C
NGS:
0.026
C90:
0.000
EMF1-2

UniProt

c.1189G>A p.Ala397Thr missense variant moderate contig885 2075

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1199G>A p.Arg400Lys missense variant moderate contig885 2085

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1409G>A p.Arg470Lys missense variant moderate contig885 2295

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1828A>G p.Ile610Val missense variant moderate contig885 2714

IGV: Start, Jump

A/G
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.2008C>T p.Pro670Ser missense variant moderate contig885 2894

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.2256A>T p.Lys752Asn missense variant moderate contig885 3142

IGV: Start, Jump

A/T
NGS:
0.026
C90:
0.000
EMF1-2

UniProt

c.2653A>G p.Thr885Ala missense variant moderate contig885 3539

IGV: Start, Jump

A/G
NGS:
0.007
C90:
0.000
PHL-2 c.61G>A p.Val21Ile missense variant moderate contig2621 337630

IGV: Start, Jump

G/A
NGS:
0.002
C90:
0.000
PHL-2 c.455A>C p.Asp152Ala missense variant moderate contig2621 339191

IGV: Start, Jump

A/C
NGS:
0.018
C90:
0.507
PHL-2 c.722G>A p.Gly241Glu missense variant moderate contig2621 339860

IGV: Start, Jump

G/A
NGS:
0.002
C90:
0.000
PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

A/G
NGS:
0.096
C90:
0.555
PHL-2 c.1696T>G p.Leu566Val missense variant moderate contig2621 340974

IGV: Start, Jump

T/G
NGS:
0.002
C90:
0.000
PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

T/A
NGS:
0.064
C90:
0.732
PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.746
PHL-2 c.2602G>A p.Asp868Asn missense variant moderate contig2621 342645

IGV: Start, Jump

G/A
NGS:
0.002
C90:
0.000
PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

G/A
NGS:
0.107
C90:
0.890
PHL-2 c.3209A>G p.Gln1070Arg missense variant moderate contig2621 343252

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.885
PHL-2 c.3235G>A p.Gly1079Ser missense variant moderate contig2621 343278

IGV: Start, Jump

G/A
NGS:
0.002
C90:
0.000
PKSG-4a

UniProt

c.37C>G p.Gln13Glu missense variant moderate contig700 1936734

IGV: Start, Jump

C/G
NGS:
0.031
C90:
0.000
PKSG-2a

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1944273

IGV: Start, Jump

T/C
NGS:
0.101
C90:
0.967
PKSG-2a

UniProt

c.948T>G p.Asp316Glu missense variant moderate contig700 1944442

IGV: Start, Jump

A/C
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.945T>G p.Ser315Arg missense variant moderate contig700 1944445

IGV: Start, Jump

A/C
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.944G>A p.Ser315Asn missense variant moderate contig700 1944446

IGV: Start, Jump

C/T
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1944456

IGV: Start, Jump

G/C
NGS:
0.070
C90:
0.000
PKSG-2a

UniProt

c.162C>A p.Asp54Glu missense variant moderate contig700 1945228

IGV: Start, Jump

G/T
NGS:
0.011
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.67A>T p.Ile23Phe missense variant moderate contig700 1951815

IGV: Start, Jump

T/A
NGS:
0.033
C90:
0.325
PKSG-4b

UniProt

c.544G>T p.Gly182Trp missense variant moderate contig700 2721129

IGV: Start, Jump

C/A
NGS:
0.055
C90:
0.000
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.353_354insCC p.Gly119fs frameshift variant high contig700 2721319

IGV: Start, Jump

T/TGG
NGS:
0.175
C90:
0.000
PKSG-4b

UniProt

c.338G>A p.Gly113Glu missense variant moderate contig700 2721335

IGV: Start, Jump

C/T
NGS:
0.046
C90:
0.000
PKSG-4b

UniProt

c.235_239dupAGATT p.Phe80fs frameshift variant high contig700 2724195

IGV: Start, Jump

G/GAATCT
NGS:
0.018
C90:
0.000
PKSG-4b

UniProt

c.134G>A p.Arg45Gln missense variant moderate contig700 2724301

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.000
AAE1-1

UniProt

c.1481C>T p.Ala494Val missense variant moderate contig606 3242790

IGV: Start, Jump

G/A
NGS:
0.002
C90:
0.000
AAE1-1

UniProt

c.454A>G p.Lys152Glu missense variant moderate contig606 3243817

IGV: Start, Jump

T/C
NGS:
0.007
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
OAC-1

UniProt

c.22G>A p.Val8Ile missense variant moderate contig931 118442

IGV: Start, Jump

C/T
NGS:
0.004
C90:
0.000
FAD2-2

UniProt

c.161T>A p.Leu54His missense variant moderate contig83 1803208

IGV: Start, Jump

A/T
NGS:
0.156
C90:
0.000
FAD2-2

UniProt

c.91T>G p.Trp31Gly missense variant moderate contig83 1803278

IGV: Start, Jump

A/C
NGS:
0.002
C90:
0.000
FAD2-2

UniProt

c.75C>A p.His25Gln missense variant moderate contig83 1803294

IGV: Start, Jump

G/T
NGS:
0.007
C90:
0.000
ELF3

UniProt

c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump

A/G
NGS:
0.112
C90:
0.000
ELF3

UniProt

c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump

G/C
NGS:
0.114
C90:
0.938
ELF3

UniProt

c.1366T>G p.Leu456Val missense variant moderate contig97 244197

IGV: Start, Jump

T/G
NGS:
0.015
C90:
0.000
ELF3

UniProt

c.1385C>T p.Ala462Val missense variant moderate contig97 244216

IGV: Start, Jump

C/T
NGS:
0.004
C90:
0.000
ELF3

UniProt

c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump

G/A
NGS:
0.123
C90:
0.000
ELF3

UniProt

c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.545
ELF3

UniProt

c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump

C/G
NGS:
0.123
C90:
0.632
ELF3

UniProt

c.2142_2144delTCC p.Pro715del disruptive inframe deletion moderate contig97 244965

IGV: Start, Jump

GCTC/G
NGS:
0.002
C90:
0.000
ELF3

UniProt

c.2198delG p.Arg733fs frameshift variant high contig97 245028

IGV: Start, Jump

CG/C
NGS:
0.002
C90:
0.612
ELF3

UniProt

c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump

G/T
NGS:
0.125
C90:
0.531
ELF3

UniProt

c.2200_2204delCATCA p.His734fs frameshift variant high contig97 245030

IGV: Start, Jump

TCATCA/T
NGS:
0.002
C90:
0.000
ELF3

UniProt

c.2218G>A p.Asp740Asn missense variant moderate contig97 245049

IGV: Start, Jump

G/A
NGS:
0.002
C90:
0.000
aPT4

UniProt

c.80A>G p.Lys27Arg missense variant moderate contig121 2828736

IGV: Start, Jump

A/G
NGS:
0.061
C90:
0.000
aPT4

UniProt

c.202T>A p.Leu68Ile missense variant moderate contig121 2828858

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
aPT4

UniProt

c.916C>T p.His306Tyr missense variant & splice region variant moderate contig121 2832711

IGV: Start, Jump

C/T
NGS:
0.015
C90:
0.000
aPT4

UniProt

c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump

T/C
NGS:
0.546
C90:
0.000
aPT1

UniProt

c.160A>C p.Thr54Pro missense variant moderate contig121 2835867

IGV: Start, Jump

A/C
NGS:
0.086
C90:
0.048
aPT1

UniProt

c.670T>A p.Ser224Thr missense variant moderate contig121 2840278

IGV: Start, Jump

T/A
NGS:
0.077
C90:
0.000
aPT1

UniProt

c.727G>T p.Glu243* stop gained high contig121 2841362

IGV: Start, Jump

G/T
NGS:
0.127
C90:
0.100
aPT1

UniProt

c.864C>G p.Asn288Lys missense variant moderate contig121 2842407

IGV: Start, Jump

C/G
NGS:
0.075
C90:
0.062
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
AAE1-2

UniProt

c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump

A/G
NGS:
0.123
C90:
0.000
AAE1-2

UniProt

c.525G>C p.Met175Ile missense variant moderate contig81 209487

IGV: Start, Jump

G/C
NGS:
0.002
C90:
0.000
AAE1-2

UniProt

c.948_949insA p.Asp317fs frameshift variant high contig81 209910

IGV: Start, Jump

C/CA
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.952delC p.Gln318fs frameshift variant high contig81 209912

IGV: Start, Jump

AC/A
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.953A>G p.Gln318Arg missense variant moderate contig81 209915

IGV: Start, Jump

A/G
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.955C>T p.Arg319Cys missense variant moderate contig81 209917

IGV: Start, Jump

C/T
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump

A/G
NGS:
0.116
C90:
0.000
PHL-1

UniProt

c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump

T/C
NGS:
0.123
C90:
0.000
PHL-1

UniProt

c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump

T/C
NGS:
0.116
C90:
0.890
PHL-1

UniProt

c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump

T/C
NGS:
0.107
C90:
0.904
PHL-1

UniProt

c.407G>A p.Arg136Gln missense variant moderate contig1439 1491441

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.139
PHL-1

UniProt

c.176G>A p.Gly59Glu missense variant moderate contig1439 1492817

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.000
PHL-1

UniProt

c.175G>A p.Gly59Arg missense variant moderate contig1439 1492818

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.144
TFL1

UniProt

c.413G>T p.Ser138Ile missense variant moderate contig1636 520504

IGV: Start, Jump

C/A
NGS:
0.002
C90:
0.010
TFL1

UniProt

c.314_315delCA p.Thr105fs frameshift variant high contig1636 520601

IGV: Start, Jump

CTG/C
NGS:
0.004
C90:
0.057
TFL1

UniProt

c.302-1G>A splice acceptor variant & intron variant high contig1636 520616

IGV: Start, Jump

C/T
NGS:
0.103
C90:
0.794
HDS-1

UniProt

c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump

T/C
NGS:
0.099
C90:
0.861
HDS-1

UniProt

c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump

C/T
NGS:
0.167
C90:
0.000
HDS-1

UniProt

c.136G>A p.Val46Ile missense variant moderate contig1891 889256

IGV: Start, Jump

C/T
NGS:
0.088
C90:
0.593
HDS-1

UniProt

c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump

G/C
NGS:
0.125
C90:
0.943
HDS-1

UniProt

c.35G>A p.Cys12Tyr missense variant moderate contig1891 889357

IGV: Start, Jump

C/T
NGS:
0.094
C90:
0.646
HDS-1

UniProt

c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump

A/AC
NGS:
0.217
C90:
0.000
FAD2

UniProt

c.148G>A p.Val50Ile missense variant moderate contig1460 1084112

IGV: Start, Jump

C/T
NGS:
0.004
C90:
0.000
FAD2

UniProt

c.124C>A p.Pro42Thr missense variant moderate contig1460 1084136

IGV: Start, Jump

G/T
NGS:
0.007
C90:
0.000
FAD2

UniProt

c.94A>G p.Thr32Ala missense variant moderate contig1460 1084166

IGV: Start, Jump

T/C
NGS:
0.015
C90:
0.000
PIE1-2

UniProt

c.6653A>G p.Asn2218Ser missense variant moderate contig1460 1184434

IGV: Start, Jump

T/C
NGS:
0.059
C90:
0.928
PIE1-2

UniProt

c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump

T/C
NGS:
0.061
C90:
0.268
PIE1-2

UniProt

c.2083_2085delGTC p.Val695del conservative inframe deletion moderate contig1460 1189954

IGV: Start, Jump

GGAC/G
NGS:
0.046
C90:
0.880
PIE1-2

UniProt

c.2072A>G p.His691Arg missense variant moderate contig1460 1189968

IGV: Start, Jump

T/C
NGS:
0.046
C90:
0.789
PIE1-2

UniProt

c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump

A/T
NGS:
0.086
C90:
0.990
PIE1-2

UniProt

c.1652C>T p.Ala551Val missense variant moderate contig1460 1191578

IGV: Start, Jump

G/A
NGS:
0.004
C90:
0.000
PIE1-2

UniProt

c.1630G>C p.Ala544Pro missense variant moderate contig1460 1191600

IGV: Start, Jump

C/G
NGS:
0.070
C90:
0.933
PIE1-2

UniProt

c.1289A>G p.Asp430Gly missense variant moderate contig1460 1192109

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
PIE1-2

UniProt

c.1156T>G p.Trp386Gly missense variant moderate contig1460 1192242

IGV: Start, Jump

A/C
NGS:
0.009
C90:
0.976
PIE1-2

UniProt

c.982G>A p.Glu328Lys missense variant moderate contig1460 1192416

IGV: Start, Jump

C/T
NGS:
0.050
C90:
0.976
PIE1-2

UniProt

c.902-2A>T splice acceptor variant & intron variant high contig1460 1192498

IGV: Start, Jump

T/A
NGS:
0.002
C90:
0.000
PIE1-2

UniProt

c.710C>T p.Pro237Leu missense variant moderate contig1460 1193804

IGV: Start, Jump

G/A
NGS:
0.072
C90:
0.866
PIE1-2

UniProt

c.706T>C p.Tyr236His missense variant moderate contig1460 1193808

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.737
PIE1-2

UniProt

c.637T>A p.Ser213Thr missense variant moderate contig1460 1194421

IGV: Start, Jump

A/T
NGS:
0.079
C90:
0.885
EMF2

UniProt

c.434C>T p.Ser145Phe missense variant moderate contig954 3049270

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.057
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
EMF1-1

UniProt

c.62C>G p.Thr21Ser missense variant moderate contig883 268910

IGV: Start, Jump

C/G
NGS:
0.007
C90:
0.000
EMF1-1

UniProt

c.389G>A p.Arg130Gln missense variant moderate contig883 269878

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-1

UniProt

c.476A>T p.Asn159Ile missense variant moderate contig883 269965

IGV: Start, Jump

A/T
NGS:
0.007
C90:
0.000
EMF1-1

UniProt

c.590A>T p.Lys197Ile missense variant moderate contig883 270079

IGV: Start, Jump

A/T
NGS:
0.007
C90:
0.000
FT

UniProt

c.13C>G p.Leu5Val missense variant moderate contig1561 3124437

IGV: Start, Jump

C/G
NGS:
0.031
C90:
0.153
FT

UniProt

c.41_43dupATA p.Asn14dup disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump

T/TTAA
NGS:
0.020
C90:
0.000
FT

UniProt

c.43_44insATAATAATAATAATAATAATAATAATAATAATA p.Asn14_Ser15insAsnAsnAsnAsnAsnAsnAsnAsnAsnAsnAsn disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump

T/TTAATAATAATAATAATAATAATAATAATAATAA
NGS:
0.004
C90:
0.000
FT

UniProt

c.43_44insATAATAATAATAATAATAATAATAATAATAATAATA p.Asn14_Ser15insAsnAsnAsnAsnAsnAsnAsnAsnAsnAsnAsnAsn disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump

T/TTAATAATAATAATAATAATAATAATAATAATAATAA
NGS:
0.004
C90:
0.000
FT

UniProt

c.175C>G p.Leu59Val missense variant moderate contig1561 3124599

IGV: Start, Jump

C/G
NGS:
0.004
C90:
0.000
FT

UniProt

c.196A>G p.Ile66Val missense variant moderate contig1561 3124620

IGV: Start, Jump

A/G
NGS:
0.004
C90:
0.033
FT

UniProt

c.205C>G p.Gln69Glu missense variant moderate contig1561 3124629

IGV: Start, Jump

C/G
NGS:
0.002
C90:
0.000
FT

UniProt

c.240C>G p.Asn80Lys missense variant moderate contig1561 3124664

IGV: Start, Jump

C/G
NGS:
0.075
C90:
0.000
FT

UniProt

c.260-1G>A splice acceptor variant & intron variant high contig1561 3125000

IGV: Start, Jump

G/A
NGS:
0.002
C90:
0.000
FT

UniProt

c.276_277insGGTGTCCCTAA p.Met93fs frameshift variant & splice region variant high contig1561 3125016

IGV: Start, Jump

T/TAGGTGTCCCTA
NGS:
0.002
C90:
0.000
FT

UniProt

c.278+1G>T splice donor variant & intron variant high contig1561 3125020

IGV: Start, Jump

G/T
NGS:
0.002
C90:
0.000
FT

UniProt

c.420C>A p.Ser140Arg missense variant moderate contig1561 3126659

IGV: Start, Jump

C/A
NGS:
0.004
C90:
0.000
FLD

UniProt

c.2981T>C p.Met994Thr missense variant moderate contig1450 2044012

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.478
FLD

UniProt

c.2964C>A p.Asp988Glu missense variant moderate contig1450 2044029

IGV: Start, Jump

G/T
NGS:
0.057
C90:
0.464
FLD

UniProt

c.2929T>C p.Phe977Leu missense variant moderate contig1450 2044103

IGV: Start, Jump

A/G
NGS:
0.026
C90:
0.349
FLD

UniProt

c.2869C>T p.His957Tyr missense variant moderate contig1450 2044163

IGV: Start, Jump

G/A
NGS:
0.011
C90:
0.000
FLD

UniProt

c.2831A>G p.Glu944Gly missense variant moderate contig1450 2044201

IGV: Start, Jump

T/C
NGS:
0.011
C90:
0.000
FLD

UniProt

c.125G>A p.Ser42Asn missense variant moderate contig1450 2047909

IGV: Start, Jump

C/T
NGS:
0.037
C90:
0.388
AAE1-3

UniProt

c.667G>A p.Val223Ile missense variant moderate contig976 1083187

IGV: Start, Jump

C/T
NGS:
0.048
C90:
0.000
AAE1-3

UniProt

c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump

C/G
NGS:
0.116
C90:
0.000
AAE1-3

UniProt

c.475G>A p.Gly159Arg missense variant moderate contig976 1083550

IGV: Start, Jump

C/T
NGS:
0.048
C90:
0.000
AAE1-3

UniProt

c.416T>C p.Leu139Pro missense variant moderate contig976 1083609

IGV: Start, Jump

A/G
NGS:
0.061
C90:
0.000
AAE1-3

UniProt

c.382T>C p.Tyr128His missense variant moderate contig976 1083643

IGV: Start, Jump

A/G
NGS:
0.072
C90:
0.000
AAE1-3

UniProt

c.296C>T p.Pro99Leu missense variant moderate contig976 1083729

IGV: Start, Jump

G/A
NGS:
0.046
C90:
0.000
AAE1-3

UniProt

c.293A>G p.Asp98Gly missense variant moderate contig976 1083732

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.284A>T p.Glu95Val missense variant moderate contig976 1083741

IGV: Start, Jump

T/A
NGS:
0.053
C90:
0.000
AAE1-3

UniProt

c.181G>A p.Val61Ile missense variant moderate contig976 1083894

IGV: Start, Jump

C/T
NGS:
0.055
C90:
0.000
AAE1-3

UniProt

c.167A>G p.Glu56Gly missense variant moderate contig976 1083908

IGV: Start, Jump

T/C
NGS:
0.070
C90:
0.000
AAE1-3

UniProt

c.125A>G p.Glu42Gly missense variant moderate contig976 1083950

IGV: Start, Jump

T/C
NGS:
0.064
C90:
0.000
AAE1-3

UniProt

c.79A>G p.Thr27Ala missense variant moderate contig976 1083996

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.52G>A p.Gly18Ser missense variant moderate contig976 1084023

IGV: Start, Jump

C/T
NGS:
0.064
C90:
0.000
AAE1-3

UniProt

c.3G>A p.Met1? start lost high contig976 1084072

IGV: Start, Jump

C/T
NGS:
0.046
C90:
0.416
FAD7A-1

UniProt

c.*341_*343-7delATATATATATATATATAG splice donor variant & splice region variant & 3 prime UTR variant & intron variant high contig510 71468

IGV: Start, Jump

TATATATATATATATATAG/T
NGS:
0.013
C90:
0.000
PIE1-1

UniProt

c.773A>G p.Asn258Ser missense variant & splice region variant moderate contig1225 2279897

IGV: Start, Jump

A/G
NGS:
0.033
C90:
0.895
PIE1-1

UniProt

c.811T>C p.Tyr271His missense variant moderate contig1225 2279935

IGV: Start, Jump

T/C
NGS:
0.026
C90:
0.742
PIE1-1

UniProt

c.815C>T p.Pro272Leu missense variant moderate contig1225 2279939

IGV: Start, Jump

C/T
NGS:
0.029
C90:
0.885
PIE1-1

UniProt

c.1007-2A>T splice acceptor variant & intron variant high contig1225 2281265

IGV: Start, Jump

A/T
NGS:
0.002
C90:
0.000
PIE1-1

UniProt

c.1124_1153dupATGTGGGTGAACCAACCCAGATGGAGGATA p.Asn375_Asp384dup disruptive inframe insertion moderate contig1225 2281360

IGV: Start, Jump

A/ATGAACCAACCCAGATGGAGGATAATGTGGG
NGS:
0.011
C90:
0.000
PIE1-1

UniProt

c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump

C/G
NGS:
0.096
C90:
0.852
PIE1-1

UniProt

c.1754C>T p.Ala585Val missense variant moderate contig1225 2282182

IGV: Start, Jump

C/T
NGS:
0.004
C90:
0.000
PIE1-1

UniProt

c.3442C>T p.Arg1148Cys missense variant moderate contig1225 2285057

IGV: Start, Jump

C/T
NGS:
0.002
C90:
0.000
PIE1-1

UniProt

c.3619G>A p.Val1207Met missense variant moderate contig1225 2285234

IGV: Start, Jump

G/A
NGS:
0.042
C90:
0.000
GGR

UniProt

c.32C>A p.Thr11Lys missense variant moderate contig2282 549024

IGV: Start, Jump

C/A
NGS:
0.009
C90:
0.000
GGR

UniProt

c.317C>T p.Pro106Leu missense variant moderate contig2282 549309

IGV: Start, Jump

C/T
NGS:
0.035
C90:
0.220
GGR

UniProt

c.358_359delGC p.Ala120fs frameshift variant high contig2282 549348

IGV: Start, Jump

ACG/A
NGS:
0.009
C90:
0.000
GGR

UniProt

c.382C>T p.Leu128Phe missense variant moderate contig2282 549374

IGV: Start, Jump

C/T
NGS:
0.024
C90:
0.000
GGR

UniProt

c.456T>A p.His152Gln missense variant moderate contig2282 549448

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
GGR

UniProt

c.460G>A p.Asp154Asn missense variant moderate contig2282 549452

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
GGR

UniProt

c.514A>T p.Ile172Phe missense variant moderate contig2282 549506

IGV: Start, Jump

A/T
NGS:
0.004
C90:
0.000
GGR

UniProt

c.541G>A p.Val181Ile missense variant moderate contig2282 549533

IGV: Start, Jump

G/A
NGS:
0.009
C90:
0.000
GGR

UniProt

c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump

A/T
NGS:
0.121
C90:
0.000
PKSB-3

UniProt

c.1880_1891delATGGCCATGGCC p.His627_Gly630del disruptive inframe deletion moderate contig93 3339981

IGV: Start, Jump

CTGGCCATGGCCA/C
NGS:
0.004
C90:
0.000
PKSB-3

UniProt

c.1901C>G p.Ala634Gly missense variant moderate contig93 3340008

IGV: Start, Jump

C/G
NGS:
0.059
C90:
0.000

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8346962
Overlapping SNPs:
95
Concordance:
57

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495166
Overlapping SNPs:
2
Concordance:
2

Blockchain Registration Information

Transaction ID
5e348673058ffe6151230e1086303bed32130270bc0eb23f4d32da11fe2138b0
Stamping Certificate
Download PDF (849.4 KB)
SHASUM Hash
970e023c274bc755591a7b8b40091d3805ea11f1a3701e8ff660035062ca6c2f
QR code for RSP11205

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings