JL 4th Gen 1

RSP 11193

Grower: Medicinal Genomics

General Information

Accession Date
June 26, 2019
Reported Plant Sex
not reported

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type II

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 0.92%
Least Heterozygous Most Heterozygous

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

No variants to report

Variants (Select Genes of Interest)

PKSA-3b

UniProt

c.298G>A p.Ala100Thr missense variant moderate contig705 2271640

IGV: Start, Jump

C/T
NGS:
0.044
C90:
0.177
PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

A/G
NGS:
0.096
C90:
0.555
PHL-2 c.1096G>A p.Ala366Thr missense variant moderate contig2621 340374

IGV: Start, Jump

G/A
NGS:
0.090
C90:
0.531
PHL-2 c.1540A>G p.Thr514Ala missense variant moderate contig2621 340818

IGV: Start, Jump

A/G
NGS:
0.042
C90:
0.282
PHL-2 c.2756A>C p.Glu919Ala missense variant moderate contig2621 342799

IGV: Start, Jump

A/C
NGS:
0.064
C90:
0.675
PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

G/A
NGS:
0.107
C90:
0.890
PHL-2 c.3002A>G p.Tyr1001Cys missense variant moderate contig2621 343045

IGV: Start, Jump

A/G
NGS:
0.055
C90:
0.316
PHL-2 c.3027G>T p.Lys1009Asn missense variant moderate contig2621 343070

IGV: Start, Jump

G/T
NGS:
0.055
C90:
0.311
PHL-2 c.3033T>G p.Cys1011Trp missense variant moderate contig2621 343076

IGV: Start, Jump

T/G
NGS:
0.055
C90:
0.292
PHL-2 c.3202A>C p.Thr1068Pro missense variant moderate contig2621 343245

IGV: Start, Jump

A/C
NGS:
0.053
C90:
0.000
PHL-2 c.3209A>G p.Gln1070Arg missense variant moderate contig2621 343252

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.885
PKSG-2a

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1944616

IGV: Start, Jump

C/T
NGS:
0.123
C90:
0.000
PKSG-2a

UniProt

c.718T>A p.Phe240Ile missense variant moderate contig700 1944672

IGV: Start, Jump

A/T
NGS:
0.002
C90:
0.000
PKSG-2a

UniProt

c.560C>T p.Thr187Met missense variant moderate contig700 1944830

IGV: Start, Jump

G/A
NGS:
0.004
C90:
0.000
PKSG-2a

UniProt

c.558G>A p.Met186Ile missense variant moderate contig700 1944832

IGV: Start, Jump

C/T
NGS:
0.004
C90:
0.000
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2b

UniProt

c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump

A/T
NGS:
0.715
C90:
0.895
PKSG-2b

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump

G/C
NGS:
0.717
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.718T>A p.Phe240Ile missense variant moderate contig700 1950920

IGV: Start, Jump

A/T
NGS:
0.114
C90:
0.000
PKSG-2b

UniProt

c.230T>C p.Val77Ala missense variant moderate contig700 1951408

IGV: Start, Jump

A/G
NGS:
0.134
C90:
0.646
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-4b

UniProt

c.544G>T p.Gly182Trp missense variant moderate contig700 2721129

IGV: Start, Jump

C/A
NGS:
0.055
C90:
0.000
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.353_354insCC p.Gly119fs frameshift variant high contig700 2721319

IGV: Start, Jump

T/TGG
NGS:
0.175
C90:
0.000
PKSG-4b

UniProt

c.338G>A p.Gly113Glu missense variant moderate contig700 2721335

IGV: Start, Jump

C/T
NGS:
0.046
C90:
0.000
PKSG-4b

UniProt

c.235_239dupAGATT p.Phe80fs frameshift variant high contig700 2724195

IGV: Start, Jump

G/GAATCT
NGS:
0.018
C90:
0.000
PKSG-4b

UniProt

c.134G>A p.Arg45Gln missense variant moderate contig700 2724301

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
OAC-2

UniProt

c.22G>A p.Val8Ile missense variant moderate contig931 110317

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.000
OAC-1

UniProt

c.185C>T p.Thr62Ile missense variant moderate contig931 118179

IGV: Start, Jump

G/A
NGS:
0.039
C90:
0.000
OAC-1

UniProt

c.175G>A p.Val59Ile missense variant moderate contig931 118189

IGV: Start, Jump

C/T
NGS:
0.026
C90:
0.000
FAD2-2

UniProt

c.164A>G p.His55Arg missense variant moderate contig83 1803205

IGV: Start, Jump

T/C
NGS:
0.037
C90:
0.000
FAD2-2

UniProt

c.161T>A p.Leu54His missense variant moderate contig83 1803208

IGV: Start, Jump

A/T
NGS:
0.156
C90:
0.000
FAD2-2

UniProt

c.64G>T p.Ala22Ser missense variant moderate contig83 1803305

IGV: Start, Jump

C/A
NGS:
0.048
C90:
0.000
ELF3

UniProt

c.358G>A p.Gly120Arg missense variant moderate contig97 242064

IGV: Start, Jump

G/A
NGS:
0.099
C90:
0.493
ELF3

UniProt

c.520A>C p.Asn174His missense variant moderate contig97 242226

IGV: Start, Jump

A/C
NGS:
0.094
C90:
0.502
ELF3

UniProt

c.752G>T p.Gly251Val missense variant moderate contig97 242458

IGV: Start, Jump

G/T
NGS:
0.022
C90:
0.139
ELF3

UniProt

c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump

A/G
NGS:
0.112
C90:
0.000
ELF3

UniProt

c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump

G/C
NGS:
0.114
C90:
0.938
ELF3

UniProt

c.1230-2_1230-1delAG splice acceptor variant & intron variant high contig97 243676

IGV: Start, Jump

TAG/T
NGS:
0.088
C90:
0.450
ELF3

UniProt

c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump

G/A
NGS:
0.123
C90:
0.000
ELF3

UniProt

c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump

C/G
NGS:
0.123
C90:
0.632
ELF3

UniProt

c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump

G/T
NGS:
0.125
C90:
0.531
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.202T>A p.Leu68Ile missense variant moderate contig121 2828858

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT1

UniProt

c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump

A/G
NGS:
0.579
C90:
0.761
aPT1

UniProt

c.727G>T p.Glu243* stop gained high contig121 2841362

IGV: Start, Jump

G/T
NGS:
0.127
C90:
0.100
aPT1

UniProt

c.864C>G p.Asn288Lys missense variant moderate contig121 2842407

IGV: Start, Jump

C/G
NGS:
0.075
C90:
0.062
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000
AAE1-2

UniProt

c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump

A/G
NGS:
0.123
C90:
0.000
AAE1-2

UniProt

c.948_949insA p.Asp317fs frameshift variant high contig81 209910

IGV: Start, Jump

C/CA
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.952delC p.Gln318fs frameshift variant high contig81 209912

IGV: Start, Jump

AC/A
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.953A>G p.Gln318Arg missense variant moderate contig81 209915

IGV: Start, Jump

A/G
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.955C>T p.Arg319Cys missense variant moderate contig81 209917

IGV: Start, Jump

C/T
NGS:
0.050
C90:
0.000
AAE1-2

UniProt

c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump

A/G
NGS:
0.116
C90:
0.000
PHL-1

UniProt

c.2651C>T p.Ala884Val missense variant moderate contig1439 1487146

IGV: Start, Jump

G/A
NGS:
0.044
C90:
0.622
PHL-1

UniProt

c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump

T/C
NGS:
0.123
C90:
0.000
PHL-1

UniProt

c.2561A>T p.Asn854Ile missense variant moderate contig1439 1487236

IGV: Start, Jump

T/A
NGS:
0.046
C90:
0.612
PHL-1

UniProt

c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump

T/C
NGS:
0.116
C90:
0.890
PHL-1

UniProt

c.1387A>G p.Thr463Ala missense variant moderate contig1439 1489811

IGV: Start, Jump

T/C
NGS:
0.107
C90:
0.904
TFL1

UniProt

c.302-1G>A splice acceptor variant & intron variant high contig1636 520616

IGV: Start, Jump

C/T
NGS:
0.103
C90:
0.794
TFL1

UniProt

c.47_48dupAT p.Val17fs frameshift variant high contig1636 521258

IGV: Start, Jump

C/CAT
NGS:
0.026
C90:
0.211
FAD4

UniProt

c.121G>T p.Val41Phe missense variant moderate contig784 1690873

IGV: Start, Jump

G/T
NGS:
0.044
C90:
0.000
FAD4

UniProt

c.220C>G p.Arg74Gly missense variant moderate contig784 1690972

IGV: Start, Jump

C/G
NGS:
0.026
C90:
0.000
HDS-1

UniProt

c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump

C/T
NGS:
0.167
C90:
0.000
HDS-1

UniProt

c.136G>A p.Val46Ile missense variant moderate contig1891 889256

IGV: Start, Jump

C/T
NGS:
0.088
C90:
0.593
HDS-1

UniProt

c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump

G/C
NGS:
0.125
C90:
0.943
HDS-1

UniProt

c.35G>A p.Cys12Tyr missense variant moderate contig1891 889357

IGV: Start, Jump

C/T
NGS:
0.094
C90:
0.646
HDS-1

UniProt

c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump

A/AC
NGS:
0.217
C90:
0.000
FT

UniProt

c.32_43dupATAATAATAATA p.Asn11_Asn14dup disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump

T/TTAATAATAATAA
NGS:
0.066
C90:
0.000
FT

UniProt

c.23_43dupATAATAATAATAATAATAATA p.Asn8_Asn14dup disruptive inframe insertion moderate contig1561 3124441

IGV: Start, Jump

T/TTAATAATAATAATAATAATAA
NGS:
0.020
C90:
0.000
FT

UniProt

c.240C>G p.Asn80Lys missense variant moderate contig1561 3124664

IGV: Start, Jump

C/G
NGS:
0.075
C90:
0.000
AAE1-3

UniProt

c.722G>A p.Arg241Lys missense variant moderate contig976 1083132

IGV: Start, Jump

C/T
NGS:
0.070
C90:
0.000
AAE1-3

UniProt

c.667G>A p.Val223Ile missense variant moderate contig976 1083187

IGV: Start, Jump

C/T
NGS:
0.048
C90:
0.000
AAE1-3

UniProt

c.659G>A p.Arg220Gln missense variant moderate contig976 1083195

IGV: Start, Jump

C/T
NGS:
0.077
C90:
0.000
AAE1-3

UniProt

c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump

C/G
NGS:
0.116
C90:
0.000
AAE1-3

UniProt

c.475G>A p.Gly159Arg missense variant moderate contig976 1083550

IGV: Start, Jump

C/T
NGS:
0.048
C90:
0.000
AAE1-3

UniProt

c.416T>C p.Leu139Pro missense variant moderate contig976 1083609

IGV: Start, Jump

A/G
NGS:
0.061
C90:
0.000
AAE1-3

UniProt

c.382T>C p.Tyr128His missense variant moderate contig976 1083643

IGV: Start, Jump

A/G
NGS:
0.072
C90:
0.000
AAE1-3

UniProt

c.296C>T p.Pro99Leu missense variant moderate contig976 1083729

IGV: Start, Jump

G/A
NGS:
0.046
C90:
0.000
AAE1-3

UniProt

c.293A>G p.Asp98Gly missense variant moderate contig976 1083732

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.284A>T p.Glu95Val missense variant moderate contig976 1083741

IGV: Start, Jump

T/A
NGS:
0.053
C90:
0.000
AAE1-3

UniProt

c.199A>G p.Asn67Asp missense variant moderate contig976 1083876

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
AAE1-3

UniProt

c.188A>G p.Asn63Ser missense variant moderate contig976 1083887

IGV: Start, Jump

T/C
NGS:
0.077
C90:
0.000
AAE1-3

UniProt

c.181G>A p.Val61Ile missense variant moderate contig976 1083894

IGV: Start, Jump

C/T
NGS:
0.055
C90:
0.000
AAE1-3

UniProt

c.167A>G p.Glu56Gly missense variant moderate contig976 1083908

IGV: Start, Jump

T/C
NGS:
0.070
C90:
0.000
AAE1-3

UniProt

c.125A>G p.Glu42Gly missense variant moderate contig976 1083950

IGV: Start, Jump

T/C
NGS:
0.064
C90:
0.000
AAE1-3

UniProt

c.79A>G p.Thr27Ala missense variant moderate contig976 1083996

IGV: Start, Jump

T/C
NGS:
0.068
C90:
0.000
AAE1-3

UniProt

c.52G>A p.Gly18Ser missense variant moderate contig976 1084023

IGV: Start, Jump

C/T
NGS:
0.064
C90:
0.000
AAE1-3

UniProt

c.3G>A p.Met1? start lost high contig976 1084072

IGV: Start, Jump

C/T
NGS:
0.046
C90:
0.416
FAD7A-1

UniProt

c.*340_*343-4delTATATATATATATATATAGATA splice donor variant & splice region variant & 3 prime UTR variant & intron variant high contig510 71467

IGV: Start, Jump

CTATATATATATATATATAGATA/C
NGS:
0.007
C90:
0.000
GGR

UniProt

c.317C>T p.Pro106Leu missense variant moderate contig2282 549309

IGV: Start, Jump

C/T
NGS:
0.035
C90:
0.220
GGR

UniProt

c.456T>A p.His152Gln missense variant moderate contig2282 549448

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
GGR

UniProt

c.460G>A p.Asp154Asn missense variant moderate contig2282 549452

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
GGR

UniProt

c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump

A/T
NGS:
0.121
C90:
0.000
GGR

UniProt

c.810A>T p.Glu270Asp missense variant moderate contig2282 549802

IGV: Start, Jump

A/T
NGS:
0.024
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.075 0.150 0.225 0.300
clone distance sibling distance more distant
  1. 0.097 JL 4th Gen 3 (RSP11195)
  2. 0.104 JL 4th Gen 6 (RSP11200)
  3. 0.117 JL 4th Gen 4 (RSP11198)
  4. 0.119 JL 4th Gen 2 (RSP11194)
  5. 0.131 JL 3rd Gen Mother (RSP11214)
  6. 0.138 JL yellow (RSP11075)
  7. 0.141 JL 3rd Gen Mother (RSP11197)
  8. 0.149 Jamaican Lions Ancestor (RSP11127)
  9. 0.155 JL 4th Gen 5 (RSP11199)
  10. 0.170 JL 4th Gen 7 (RSP11153)
  11. 0.176 JL 3rd Gen Father (RSP11196)
  12. 0.275 CST (RSP11002)
  13. 0.275 Super Blue Dream (RSP11011)
  14. 0.276 Blue Dream (RSP11342)
  15. 0.279 Italian Kiss (RSP10990)
  16. 0.281 Blue Dream (RSP11012)
  17. 0.282 Blue Dream (RSP11005)
  18. 0.283 RKM-2018-023 (RSP11115)
  19. 0.285 Blue Dream (RSP11006)
  20. 0.286 Blue Dream (RSP11032)

Nearest genetic relatives (Base Tree)

0 0.083 0.167 0.250 0.333
clone distance sibling distance more distant
  1. 0.143 JL yellow (RSP11075)
  2. 0.270 CST (RSP11002)
  3. 0.276 RKM-2018-023 (RSP11115)
  4. 0.284 Blue Dream (RSP11033)
  5. 0.287 Skunk 18 (RSP11038)
  6. 0.290 Italian Kiss (RSP11034)
  7. 0.292 RKM-2018-027 (RSP11119)
  8. 0.297 RKM-2018-006 (RSP11097)
  9. 0.297 Gold Cracker (RSP11048)
  10. 0.299 RKM-2018-003 (RSP11094)
  11. 0.301 Blueberry Cheesecake (RSP10680)
  12. 0.302 Golden Goat 2 (RSP10991)
  13. 0.310 Blueberry Cheesecake (RSP10684)
  14. 0.310 RKM-2018-020 (RSP11112)
  15. 0.312 Sour Raspberry (RSP10551)
  16. 0.315 RKM-2018-031 (RSP11123)
  17. 0.315 Liberty Haze (RSP11000)
  18. 0.315 Hermaphrodite ResearchSample2 (RSP11050)
  19. 0.316 UP Sunrise (RSP10989)
  20. 0.318 QUEEN JESUS (RSP10105)

Most genetically distant strains (All Samples)

0 0.125 0.250 0.375 0.500
clone distance sibling distance more distant
  1. 0.480 Cherry Blossom (RSP11318)
  2. 0.465 Cherry Blossom (RSP11335)
  3. 0.463 Cherry Blossom (RSP11308)
  4. 0.458 Cherry Blossom (RSP11317)
  5. 0.455 Cherry Blossom (RSP11311)
  6. 0.454 Cherry Blossom (RSP11333)
  7. 0.453 Cherry Blossom (RSP11323)
  8. 0.448 Cherry Blossom (RSP11306)
  9. 0.440 Cherry Blossom (RSP11300)
  10. 0.439 Cherry Blossom (RSP11328)
  11. 0.435 Cherry Blossom (RSP11326)
  12. 0.433 Cherry Blossom (RSP11334)
  13. 0.433 80E (RSP11213)
  14. 0.432 Cherry Blossom (RSP11330)
  15. 0.432 Cherry Blossom (RSP11322)
  16. 0.431 Cherry Blossom (RSP11304)
  17. 0.430 Cherry Blossom (RSP11329)
  18. 0.429 Cherry Blossom (RSP11302)
  19. 0.428 Cherry Blossom (RSP11298)
  20. 0.428 Cherry Blossom (RSP11301)

Most genetically distant strains (Base Tree)

0 0.108 0.217 0.325 0.433
clone distance sibling distance more distant
  1. 0.402 Kush Hemp E1 (RSP11128)
  2. 0.400 Cherry (RSP11142)
  3. 0.389 Cbot-2019-005 (RSP11133)
  4. 0.388 Cherry (RSP11143)
  5. 0.385 Skywalker OG (RSP10837)
  6. 0.383 RKM-2018-002 (RSP11093)
  7. 0.377 Cbot-2019-001 (RSP11129)
  8. 0.376 Santhica27 (RSP11047)
  9. 0.371 USO 31 (RSP10981)
  10. 0.370 Feral (RSP10890)
  11. 0.370 Carmagnola (RSP11037)
  12. 0.363 RKM-2018-026 (RSP11118)
  13. 0.362 RKM-2018-028 (RSP11120)
  14. 0.361 RKM-2018-018 (RSP11110)
  15. 0.360 Tisza (RSP10659)
  16. 0.360 RKM-2018-022 (RSP11114)
  17. 0.360 Futura 75 (RSP10664)
  18. 0.359 Hermaphrodite Research Sample1 (RSP11049)
  19. 0.357 Monoica (RSP10241)
  20. 0.356 RKM-2018-032 (RSP11124)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4451125
Overlapping SNPs:
100
Concordance:
62

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495249
Overlapping SNPs:
10
Concordance:
7

Blockchain Registration Information

Transaction ID
f590df7d905c1ca6123209fe211daef005424188b572a2af73b026b1f7146808
Stamping Certificate
Download PDF (844.7 KB)
SHASUM Hash
6f1633ee977f9c1f4d0eecd955528332ce4fb7b9a5db8ef9f9c359a398145adb
QR code for RSP11193

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings