Doug's Varin

RSP 11243

Grower: flower

General Information

Accession Date
August 12, 2019
Reported Plant Sex
unknown

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Common
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Unknown

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.2%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0190
male female RSP11243

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

THCAS c.1064G>A p.Ser355Asn missense variant moderate contig741 4416764

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.000
THCAS c.998C>G p.Pro333Arg missense variant moderate contig741 4416830

IGV: Start, Jump

G/C
NGS:
0.182
C90:
0.000

Variants (Select Genes of Interest)

GPPs1

UniProt

c.744C>G p.Asp248Glu missense variant moderate contig676 168993

IGV: Start, Jump

C/G
NGS:
0.022
C90:
0.000
GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
EMF1-2

UniProt

c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

A/C
NGS:
0.090
C90:
0.474
PHL-2 c.841A>T p.Ser281Cys missense variant moderate contig2621 340119

IGV: Start, Jump

A/T
NGS:
0.011
C90:
0.000
PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

A/G
NGS:
0.096
C90:
0.555
PHL-2 c.1096G>A p.Ala366Thr missense variant moderate contig2621 340374

IGV: Start, Jump

G/A
NGS:
0.090
C90:
0.531
PHL-2 c.1540A>G p.Thr514Ala missense variant moderate contig2621 340818

IGV: Start, Jump

A/G
NGS:
0.042
C90:
0.282
PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

T/A
NGS:
0.064
C90:
0.732
PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.746
PHL-2 c.2582C>G p.Pro861Arg missense variant moderate contig2621 342625

IGV: Start, Jump

C/G
NGS:
0.002
C90:
0.000
PHL-2 c.2756A>C p.Glu919Ala missense variant moderate contig2621 342799

IGV: Start, Jump

A/C
NGS:
0.064
C90:
0.675
PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

G/A
NGS:
0.107
C90:
0.890
PHL-2 c.2830A>C p.Asn944His missense variant moderate contig2621 342873

IGV: Start, Jump

A/C
NGS:
0.044
C90:
0.000
PHL-2 c.2834A>G p.Asn945Ser missense variant moderate contig2621 342877

IGV: Start, Jump

A/G
NGS:
0.004
C90:
0.000
PHL-2 c.2933G>T p.Arg978Leu missense variant moderate contig2621 342976

IGV: Start, Jump

G/T
NGS:
0.048
C90:
0.297
PHL-2 c.2936T>G p.Val979Gly missense variant moderate contig2621 342979

IGV: Start, Jump

T/G
NGS:
0.048
C90:
0.000
PHL-2 c.3002A>G p.Tyr1001Cys missense variant moderate contig2621 343045

IGV: Start, Jump

A/G
NGS:
0.055
C90:
0.316
PHL-2 c.3202A>C p.Thr1068Pro missense variant moderate contig2621 343245

IGV: Start, Jump

A/C
NGS:
0.053
C90:
0.000
PHL-2 c.3209A>G p.Gln1070Arg missense variant moderate contig2621 343252

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.885
PHL-2 c.3467A>G p.Gln1156Arg missense variant moderate contig2621 343510

IGV: Start, Jump

A/G
NGS:
0.064
C90:
0.713
PHL-2 c.3556_3557delAA p.Lys1186fs frameshift variant high contig2621 343598

IGV: Start, Jump

GAA/G
NGS:
0.013
C90:
0.096
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2b

UniProt

c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump

A/T
NGS:
0.715
C90:
0.895
PKSG-2b

UniProt

c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump

G/C
NGS:
0.717
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
PKSG-2b

UniProt

c.948T>G p.Asp316Glu missense variant moderate contig700 1950690

IGV: Start, Jump

A/C
NGS:
0.456
C90:
0.000
PKSG-2b

UniProt

c.945T>G p.Ser315Arg missense variant moderate contig700 1950693

IGV: Start, Jump

A/C
NGS:
0.454
C90:
0.000
PKSG-2b

UniProt

c.944G>A p.Ser315Asn missense variant moderate contig700 1950694

IGV: Start, Jump

C/T
NGS:
0.445
C90:
0.000
PKSG-2b

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1950704

IGV: Start, Jump

G/C
NGS:
0.410
C90:
0.000
PKSG-2b

UniProt

c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump

C/T
NGS:
0.366
C90:
0.947
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-2b

UniProt

c.-2_1dupATA start lost & conservative inframe insertion high contig700 1951880

IGV: Start, Jump

A/ATAT
NGS:
0.410
C90:
0.000
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
PKSG-4b

UniProt

c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump

CCTGT/C
NGS:
0.529
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
PKSG-4b

UniProt

c.238T>C p.Phe80Leu missense variant moderate contig700 2724197

IGV: Start, Jump

A/G
NGS:
0.013
C90:
0.000
PKSG-4b

UniProt

c.216G>C p.Leu72Phe missense variant moderate contig700 2724219

IGV: Start, Jump

C/G
NGS:
0.044
C90:
0.000
PKSG-4b

UniProt

c.206T>C p.Leu69Ser missense variant moderate contig700 2724229

IGV: Start, Jump

A/G
NGS:
0.044
C90:
0.000
OAC-2

UniProt

c.260C>G p.Ser87Cys missense variant moderate contig931 109979

IGV: Start, Jump

G/C
NGS:
0.070
C90:
0.000
OAC-2

UniProt

c.220A>G p.Ile74Val missense variant moderate contig931 110019

IGV: Start, Jump

T/C
NGS:
0.011
C90:
0.670
ELF4

UniProt

c.407G>C p.Arg136Pro missense variant moderate contig869 622163

IGV: Start, Jump

C/G
NGS:
0.024
C90:
0.000
ELF4

UniProt

c.144T>A p.Asp48Glu missense variant moderate contig869 622426

IGV: Start, Jump

A/T
NGS:
0.031
C90:
0.000
ELF3

UniProt

c.520A>C p.Asn174His missense variant moderate contig97 242226

IGV: Start, Jump

A/C
NGS:
0.094
C90:
0.502
ELF3

UniProt

c.574A>G p.Asn192Asp missense variant moderate contig97 242280

IGV: Start, Jump

A/G
NGS:
0.042
C90:
0.579
ELF3

UniProt

c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump

A/G
NGS:
0.112
C90:
0.000
ELF3

UniProt

c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump

G/C
NGS:
0.114
C90:
0.938
ELF3

UniProt

c.1230-2_1230-1delAG splice acceptor variant & intron variant high contig97 243676

IGV: Start, Jump

TAG/T
NGS:
0.088
C90:
0.450
ELF3

UniProt

c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump

G/A
NGS:
0.123
C90:
0.000
ELF3

UniProt

c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump

A/G
NGS:
0.103
C90:
0.545
ELF3

UniProt

c.1803_1805delTCA p.His601del disruptive inframe deletion moderate contig97 244625

IGV: Start, Jump

ACAT/A
NGS:
0.092
C90:
0.000
ELF3

UniProt

c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump

C/G
NGS:
0.123
C90:
0.632
ELF3

UniProt

c.2141C>G p.Pro714Arg missense variant moderate contig97 244972

IGV: Start, Jump

C/G
NGS:
0.088
C90:
0.335
ELF3

UniProt

c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump

G/T
NGS:
0.125
C90:
0.531
aPT4

UniProt

c.16G>A p.Val6Ile missense variant moderate contig121 2828672

IGV: Start, Jump

G/A
NGS:
0.158
C90:
0.000
aPT4

UniProt

c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump

T/C
NGS:
0.439
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump

A/G
NGS:
0.349
C90:
0.000
aPT4

UniProt

c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump

T/C
NGS:
0.546
C90:
0.000
aPT1

UniProt

c.160A>C p.Thr54Pro missense variant moderate contig121 2835867

IGV: Start, Jump

A/C
NGS:
0.086
C90:
0.048
aPT1

UniProt

c.629C>T p.Thr210Ile missense variant moderate contig121 2840237

IGV: Start, Jump

C/T
NGS:
0.561
C90:
0.598
aPT1

UniProt

c.727G>T p.Glu243* stop gained high contig121 2841362

IGV: Start, Jump

G/T
NGS:
0.127
C90:
0.100
HDS-2

UniProt

c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump

CGTAACCGGAACT/C
NGS:
0.805
C90:
0.000
HDS-2

UniProt

c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump

T/G
NGS:
0.721
C90:
0.000
AAE1-2

UniProt

c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump

A/G
NGS:
0.123
C90:
0.000
AAE1-2

UniProt

c.884C>G p.Thr295Ser missense variant moderate contig81 209846

IGV: Start, Jump

C/G
NGS:
0.002
C90:
0.000
AAE1-2

UniProt

c.884C>T p.Thr295Ile missense variant moderate contig81 209846

IGV: Start, Jump

C/T
NGS:
0.042
C90:
0.000
AAE1-2

UniProt

c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump

A/G
NGS:
0.116
C90:
0.000
AAE1-2

UniProt

c.1102C>A p.His368Asn missense variant moderate contig81 210064

IGV: Start, Jump

C/A
NGS:
0.033
C90:
0.000
AAE1-2

UniProt

c.1115A>G p.Glu372Gly missense variant moderate contig81 210077

IGV: Start, Jump

A/G
NGS:
0.004
C90:
0.000
AAE1-2

UniProt

c.1415G>A p.Ser472Asn missense variant moderate contig81 210377

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1417A>G p.Thr473Ala missense variant moderate contig81 210379

IGV: Start, Jump

A/G
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1434G>T p.Glu478Asp missense variant moderate contig81 210396

IGV: Start, Jump

G/T
NGS:
0.075
C90:
0.000
PHL-1

UniProt

c.2651C>T p.Ala884Val missense variant moderate contig1439 1487146

IGV: Start, Jump

G/A
NGS:
0.044
C90:
0.622
PHL-1

UniProt

c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump

T/C
NGS:
0.123
C90:
0.000
PHL-1

UniProt

c.2561A>T p.Asn854Ile missense variant moderate contig1439 1487236

IGV: Start, Jump

T/A
NGS:
0.046
C90:
0.612
PHL-1

UniProt

c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump

T/C
NGS:
0.116
C90:
0.890
Edestin

UniProt

c.16T>C p.Ser6Pro missense variant moderate contig850 3065274

IGV: Start, Jump

A/G
NGS:
0.059
C90:
0.000
TFL1

UniProt

c.302-1G>A splice acceptor variant & intron variant high contig1636 520616

IGV: Start, Jump

C/T
NGS:
0.103
C90:
0.794
HDS-1

UniProt

c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump

T/C
NGS:
0.099
C90:
0.861
HDS-1

UniProt

c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump

C/T
NGS:
0.167
C90:
0.000
HDS-1

UniProt

c.136G>A p.Val46Ile missense variant moderate contig1891 889256

IGV: Start, Jump

C/T
NGS:
0.088
C90:
0.593
HDS-1

UniProt

c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump

G/C
NGS:
0.125
C90:
0.943
HDS-1

UniProt

c.35G>A p.Cys12Tyr missense variant moderate contig1891 889357

IGV: Start, Jump

C/T
NGS:
0.094
C90:
0.646
HDS-1

UniProt

c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump

A/AC
NGS:
0.217
C90:
0.000
FAD2

UniProt

c.1115G>T p.Gly372Val missense variant moderate contig1460 1083145

IGV: Start, Jump

C/A
NGS:
0.004
C90:
0.000
PIE1-2

UniProt

c.6636T>G p.Asp2212Glu missense variant moderate contig1460 1184451

IGV: Start, Jump

A/C
NGS:
0.035
C90:
0.885
PIE1-2

UniProt

c.6623C>T p.Ala2208Val missense variant moderate contig1460 1184464

IGV: Start, Jump

G/A
NGS:
0.044
C90:
0.689
PIE1-2

UniProt

c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump

T/C
NGS:
0.061
C90:
0.268
PIE1-2

UniProt

c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump

A/T
NGS:
0.086
C90:
0.990
PIE1-2

UniProt

c.1656T>G p.Asn552Lys missense variant moderate contig1460 1191574

IGV: Start, Jump

A/C
NGS:
0.009
C90:
0.043
EMF2

UniProt

c.1487_1490delATGG p.Asp496fs frameshift variant high contig954 3057776

IGV: Start, Jump

TGATG/T
NGS:
0.002
C90:
0.000
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
FT

UniProt

c.13C>G p.Leu5Val missense variant moderate contig1561 3124437

IGV: Start, Jump

C/G
NGS:
0.031
C90:
0.153
FT

UniProt

c.334_339dupTGCTAT p.Cys112_Tyr113dup conservative inframe insertion moderate contig1561 3126370

IGV: Start, Jump

G/GTGCTAT
NGS:
0.009
C90:
0.153
FLD

UniProt

c.2964C>A p.Asp988Glu missense variant moderate contig1450 2044029

IGV: Start, Jump

G/T
NGS:
0.057
C90:
0.464
FLD

UniProt

c.2929T>C p.Phe977Leu missense variant moderate contig1450 2044103

IGV: Start, Jump

A/G
NGS:
0.026
C90:
0.349
FLD

UniProt

c.125G>A p.Ser42Asn missense variant moderate contig1450 2047909

IGV: Start, Jump

C/T
NGS:
0.037
C90:
0.388
AAE1-3

UniProt

c.722G>A p.Arg241Lys missense variant moderate contig976 1083132

IGV: Start, Jump

C/T
NGS:
0.070
C90:
0.000
AAE1-3

UniProt

c.659G>A p.Arg220Gln missense variant moderate contig976 1083195

IGV: Start, Jump

C/T
NGS:
0.077
C90:
0.000
AAE1-3

UniProt

c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump

C/G
NGS:
0.116
C90:
0.000
AAE1-3

UniProt

c.382T>C p.Tyr128His missense variant moderate contig976 1083643

IGV: Start, Jump

A/G
NGS:
0.072
C90:
0.000
AAE1-3

UniProt

c.199A>G p.Asn67Asp missense variant moderate contig976 1083876

IGV: Start, Jump

T/C
NGS:
0.079
C90:
0.000
PIE1-1

UniProt

c.1124_1153dupATGTGGGTGAACCAACCCAGATGGAGGATA p.Asn375_Asp384dup disruptive inframe insertion moderate contig1225 2281360

IGV: Start, Jump

A/ATGAACCAACCCAGATGGAGGATAATGTGGG
NGS:
0.011
C90:
0.000
PIE1-1

UniProt

c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump

C/G
NGS:
0.096
C90:
0.852
GGR

UniProt

c.362A>T p.Tyr121Phe missense variant moderate contig2282 549354

IGV: Start, Jump

A/T
NGS:
0.029
C90:
0.000
GGR

UniProt

c.456T>A p.His152Gln missense variant moderate contig2282 549448

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
GGR

UniProt

c.460G>A p.Asp154Asn missense variant moderate contig2282 549452

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
GGR

UniProt

c.679G>A p.Glu227Lys missense variant moderate contig2282 549671

IGV: Start, Jump

G/A
NGS:
0.018
C90:
0.000
GGR

UniProt

c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump

A/T
NGS:
0.121
C90:
0.000
PKSB-3

UniProt

c.1652A>G p.Glu551Gly missense variant moderate contig93 3339759

IGV: Start, Jump

A/G
NGS:
0.088
C90:
0.000
PKSB-3

UniProt

c.1850_1852dupTGA p.Met617dup disruptive inframe insertion moderate contig93 3339945

IGV: Start, Jump

A/AGAT
NGS:
0.031
C90:
0.000

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4451145
Overlapping SNPs:
54
Concordance:
40

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495279
Overlapping SNPs:
7
Concordance:
7

Blockchain Registration Information

Transaction ID
330af550c88b15088866cce0b57e674ec06c54a3ebb9dd4efc7bcc832e369caa
Stamping Certificate
Download PDF (866.8 KB)
SHASUM Hash
bfab04a6c7dd96b9de17e44cb01af45c33bada43cd6d112ebec2fb329ffc380d
QR code for RSP11243

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings