Doug's Varin

RSP 11243

Grower: flower

General Information

Accession Date
August 12, 2019
Reported Plant Sex
not reported

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Common
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.


No information provided.


No information provided.

Genetic Information

Plant Type
Type I

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.2%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0190
male female RSP11243

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

THCAS c.1064G>A p.Ser355Asn missense variant moderate contig741 4416764

IGV: Start, Jump

THCAS c.998C>G p.Pro333Arg missense variant moderate contig741 4416830

IGV: Start, Jump


Variants (Select Genes of Interest)



c.744C>G p.Asp248Glu missense variant moderate contig676 168993

IGV: Start, Jump



c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump



c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

PHL-2 c.841A>T p.Ser281Cys missense variant moderate contig2621 340119

IGV: Start, Jump

PHL-2 c.1057A>G p.Arg353Gly missense variant moderate contig2621 340335

IGV: Start, Jump

PHL-2 c.1096G>A p.Ala366Thr missense variant moderate contig2621 340374

IGV: Start, Jump

PHL-2 c.1540A>G p.Thr514Ala missense variant moderate contig2621 340818

IGV: Start, Jump

PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

PHL-2 c.2582C>G p.Pro861Arg missense variant moderate contig2621 342625

IGV: Start, Jump

PHL-2 c.2756A>C p.Glu919Ala missense variant moderate contig2621 342799

IGV: Start, Jump

PHL-2 c.2783G>A p.Ser928Asn missense variant moderate contig2621 342826

IGV: Start, Jump

PHL-2 c.2830A>C p.Asn944His missense variant moderate contig2621 342873

IGV: Start, Jump

PHL-2 c.2834A>G p.Asn945Ser missense variant moderate contig2621 342877

IGV: Start, Jump

PHL-2 c.2933G>T p.Arg978Leu missense variant moderate contig2621 342976

IGV: Start, Jump

PHL-2 c.2936T>G p.Val979Gly missense variant moderate contig2621 342979

IGV: Start, Jump

PHL-2 c.3002A>G p.Tyr1001Cys missense variant moderate contig2621 343045

IGV: Start, Jump

PHL-2 c.3202A>C p.Thr1068Pro missense variant moderate contig2621 343245

IGV: Start, Jump

PHL-2 c.3209A>G p.Gln1070Arg missense variant moderate contig2621 343252

IGV: Start, Jump

PHL-2 c.3467A>G p.Gln1156Arg missense variant moderate contig2621 343510

IGV: Start, Jump

PHL-2 c.3556_3557delAA p.Lys1186fs frameshift variant high contig2621 343598

IGV: Start, Jump



c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump



c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump



c.1132C>G p.Leu378Val missense variant moderate contig700 1950506

IGV: Start, Jump



c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump



c.948T>G p.Asp316Glu missense variant moderate contig700 1950690

IGV: Start, Jump



c.945T>G p.Ser315Arg missense variant moderate contig700 1950693

IGV: Start, Jump



c.944G>A p.Ser315Asn missense variant moderate contig700 1950694

IGV: Start, Jump



c.934C>G p.His312Asp missense variant moderate contig700 1950704

IGV: Start, Jump



c.774G>A p.Met258Ile missense variant moderate contig700 1950864

IGV: Start, Jump



c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump



c.-2_1dupATA start lost & conservative inframe insertion high contig700 1951880

IGV: Start, Jump



c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump



c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump



c.352_355delACAG p.Thr118fs frameshift variant high contig700 2721317

IGV: Start, Jump



c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump



c.238T>C p.Phe80Leu missense variant moderate contig700 2724197

IGV: Start, Jump



c.216G>C p.Leu72Phe missense variant moderate contig700 2724219

IGV: Start, Jump



c.206T>C p.Leu69Ser missense variant moderate contig700 2724229

IGV: Start, Jump



c.260C>G p.Ser87Cys missense variant moderate contig931 109979

IGV: Start, Jump



c.220A>G p.Ile74Val missense variant moderate contig931 110019

IGV: Start, Jump



c.407G>C p.Arg136Pro missense variant moderate contig869 622163

IGV: Start, Jump



c.144T>A p.Asp48Glu missense variant moderate contig869 622426

IGV: Start, Jump



c.520A>C p.Asn174His missense variant moderate contig97 242226

IGV: Start, Jump



c.574A>G p.Asn192Asp missense variant moderate contig97 242280

IGV: Start, Jump



c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump



c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump



c.1230-2_1230-1delAG splice acceptor variant & intron variant high contig97 243676

IGV: Start, Jump



c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump



c.1630A>G p.Thr544Ala missense variant moderate contig97 244461

IGV: Start, Jump



c.1803_1805delTCA p.His601del disruptive inframe deletion moderate contig97 244625

IGV: Start, Jump



c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump



c.2141C>G p.Pro714Arg missense variant moderate contig97 244972

IGV: Start, Jump



c.2198G>T p.Arg733Leu missense variant moderate contig97 245029

IGV: Start, Jump



c.16G>A p.Val6Ile missense variant moderate contig121 2828672

IGV: Start, Jump



c.97T>C p.Tyr33His missense variant moderate contig121 2828753

IGV: Start, Jump



c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump



c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump



c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump



c.302A>G p.Asn101Ser missense variant moderate contig121 2829099

IGV: Start, Jump



c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump



c.160A>C p.Thr54Pro missense variant moderate contig121 2835867

IGV: Start, Jump



c.629C>T p.Thr210Ile missense variant moderate contig121 2840237

IGV: Start, Jump



c.727G>T p.Glu243* stop gained high contig121 2841362

IGV: Start, Jump



c.82_93delGTAACCGGAACT p.Val28_Thr31del conservative inframe deletion moderate contig95 1989748

IGV: Start, Jump



c.127T>G p.Ser43Ala missense variant moderate contig95 1989794

IGV: Start, Jump



c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump



c.884C>G p.Thr295Ser missense variant moderate contig81 209846

IGV: Start, Jump



c.884C>T p.Thr295Ile missense variant moderate contig81 209846

IGV: Start, Jump



c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump



c.1102C>A p.His368Asn missense variant moderate contig81 210064

IGV: Start, Jump



c.1115A>G p.Glu372Gly missense variant moderate contig81 210077

IGV: Start, Jump



c.1415G>A p.Ser472Asn missense variant moderate contig81 210377

IGV: Start, Jump



c.1417A>G p.Thr473Ala missense variant moderate contig81 210379

IGV: Start, Jump



c.1434G>T p.Glu478Asp missense variant moderate contig81 210396

IGV: Start, Jump



c.2651C>T p.Ala884Val missense variant moderate contig1439 1487146

IGV: Start, Jump



c.2623A>G p.Thr875Ala missense variant moderate contig1439 1487174

IGV: Start, Jump



c.2561A>T p.Asn854Ile missense variant moderate contig1439 1487236

IGV: Start, Jump



c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump



c.16T>C p.Ser6Pro missense variant moderate contig850 3065274

IGV: Start, Jump



c.302-1G>A splice acceptor variant & intron variant high contig1636 520616

IGV: Start, Jump



c.1618A>G p.Ile540Val missense variant moderate contig1891 885936

IGV: Start, Jump



c.1378G>A p.Val460Ile missense variant moderate contig1891 886370

IGV: Start, Jump



c.136G>A p.Val46Ile missense variant moderate contig1891 889256

IGV: Start, Jump



c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump



c.35G>A p.Cys12Tyr missense variant moderate contig1891 889357

IGV: Start, Jump



c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump



c.1115G>T p.Gly372Val missense variant moderate contig1460 1083145

IGV: Start, Jump



c.6636T>G p.Asp2212Glu missense variant moderate contig1460 1184451

IGV: Start, Jump



c.6623C>T p.Ala2208Val missense variant moderate contig1460 1184464

IGV: Start, Jump



c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump



c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump



c.1656T>G p.Asn552Lys missense variant moderate contig1460 1191574

IGV: Start, Jump



c.1487_1490delATGG p.Asp496fs frameshift variant high contig954 3057776

IGV: Start, Jump



c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump



c.13C>G p.Leu5Val missense variant moderate contig1561 3124437

IGV: Start, Jump



c.334_339dupTGCTAT p.Cys112_Tyr113dup conservative inframe insertion moderate contig1561 3126370

IGV: Start, Jump



c.2964C>A p.Asp988Glu missense variant moderate contig1450 2044029

IGV: Start, Jump



c.2929T>C p.Phe977Leu missense variant moderate contig1450 2044103

IGV: Start, Jump



c.125G>A p.Ser42Asn missense variant moderate contig1450 2047909

IGV: Start, Jump



c.722G>A p.Arg241Lys missense variant moderate contig976 1083132

IGV: Start, Jump



c.659G>A p.Arg220Gln missense variant moderate contig976 1083195

IGV: Start, Jump



c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump



c.382T>C p.Tyr128His missense variant moderate contig976 1083643

IGV: Start, Jump



c.199A>G p.Asn67Asp missense variant moderate contig976 1083876

IGV: Start, Jump



c.1124_1153dupATGTGGGTGAACCAACCCAGATGGAGGATA p.Asn375_Asp384dup disruptive inframe insertion moderate contig1225 2281360

IGV: Start, Jump



c.1222C>G p.Gln408Glu missense variant moderate contig1225 2281482

IGV: Start, Jump



c.362A>T p.Tyr121Phe missense variant moderate contig2282 549354

IGV: Start, Jump



c.456T>A p.His152Gln missense variant moderate contig2282 549448

IGV: Start, Jump



c.460G>A p.Asp154Asn missense variant moderate contig2282 549452

IGV: Start, Jump



c.679G>A p.Glu227Lys missense variant moderate contig2282 549671

IGV: Start, Jump



c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump



c.1652A>G p.Glu551Gly missense variant moderate contig93 3339759

IGV: Start, Jump



c.1850_1852dupTGA p.Met617dup disruptive inframe insertion moderate contig93 3339945

IGV: Start, Jump


Nearest genetic relatives (All Samples)

0 0.042 0.083 0.125 0.167
clone distance sibling distance more distant
  1. 0.035 Electra (RSP11366)
  2. 0.062 Serious Happiness (RSP10763)
  3. 0.086 Lift (RSP11378)
  4. 0.095 Suver Haze (RSP11364)
  5. 0.098 Joy (RSP11380)
  6. 0.099 UnObtanium (RSP11611)
  7. 0.105 Domnesia (RSP11184)
  8. 0.107 Blue Dream (RSP11010)
  9. 0.110 CBG Berry (RSP11446)
  10. 0.110 Blue Dream (RSP11007)
  11. 0.111 Blueberry Cheesecake (RSP10684)
  12. 0.111 Blue Dream (RSP11017)
  13. 0.112 Badger (RSP11614)
  14. 0.114 JL 4th Gen 7 (RSP11153)
  15. 0.125 CBG-#40 (RSP11444)
  16. 0.126 Blue Dream (RSP11004)
  17. 0.129 JL X NSPM1 14 (RSP11473)
  18. 0.134 Lifter (RSP11365)
  19. 0.135 JL X NSPM1 7 (RSP11469)
  20. 0.137 Super Blue Dream (RSP11011)

Nearest genetic relatives (Base Tree)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.113 Blueberry Cheesecake (RSP10684)
  2. 0.153 UP Sunrise (RSP10989)
  3. 0.159 Liberty Haze (RSP11000)
  4. 0.180 Durban Poison (RSP11014)
  5. 0.182 Recon (RSP10755)
  6. 0.207 Gold Cracker (RSP11048)
  7. 0.217 Blue Dream (RSP11033)
  8. 0.219 RKM-2018-020 (RSP11112)
  9. 0.222 Golden Goat 2 (RSP10991)
  10. 0.224 Queen Jesus (RSP10105)
  11. 0.229 Italian Kiss (RSP11034)
  12. 0.235 The Gift (RSP10988)
  13. 0.235 Hermaphrodite ResearchSample2 (RSP11050)
  14. 0.238 Cbot-2019-001 (RSP11129)
  15. 0.238 CST (RSP11002)
  16. 0.241 RKM-2018-009 (RSP11100)
  17. 0.241 RKM-2018-003 (RSP11094)
  18. 0.241 Hermaphrodite Research Sample1 (RSP11049)
  19. 0.244 RKM-2018-033 (RSP11125)
  20. 0.244 Kimbo Slice (RSP10997)

Most genetically distant strains (All Samples)

0 0.108 0.217 0.325 0.433
clone distance sibling distance more distant
  1. 0.422 80E (RSP11213)
  2. 0.400 80E (RSP11212)
  3. 0.399 80E (RSP11211)
  4. 0.381 R1in136 (SRR14708226)
  5. 0.372 Cherry Blossom (RSP11323)
  6. 0.366 VIR 223 - Bernburgskaya Odnodomnaya - bm (SRR14708217)
  7. 0.366 R3in134 (SRR14708220)
  8. 0.365 R1in136 (SRR14708237)
  9. 0.365 Feral (RSP11205)
  10. 0.364 R3in134 (SRR14708235)
  11. 0.364 R3in134 (SRR14708218)
  12. 0.363 JL yellow (RSP11075)
  13. 0.363 Feral (RSP11206)
  14. 0.360 Tanao Sri-white -80- (RSP11621)
  15. 0.359 Feral (RSP10890)
  16. 0.358 XBL1 (SRR14708207)
  17. 0.358 Beniko (SRR14708275)
  18. 0.357 R1in136 (SRR14708225)
  19. 0.356 USO31 (RSP10233)
  20. 0.356 IUP3 (SRR14708256)

Most genetically distant strains (Base Tree)

0 0.092 0.183 0.275 0.367
clone distance sibling distance more distant
  1. 0.366 JL yellow (RSP11075)
  2. 0.365 Feral (RSP10890)
  3. 0.355 RKM-2018-026 (RSP11118)
  4. 0.354 Carmagnola (RSP11037)
  5. 0.353 Kush Hemp E1 (RSP11128)
  6. 0.348 Ivory (RSP10668)
  7. 0.344 RKM-2018-002 (RSP11093)
  8. 0.342 Monoica (RSP10241)
  9. 0.342 Santhica27 (RSP11047)
  10. 0.341 USO 31 (RSP10981)
  11. 0.334 Carmagnola (RSP10979)
  12. 0.333 Cbot-2019-005 (RSP11133)
  13. 0.332 Lovrin (RSP10658)
  14. 0.331 Futura 75 (RSP10664)
  15. 0.329 Skywalker OG (RSP10837)
  16. 0.318 Kyrgyz Gold (RSP11054)
  17. 0.313 Fedora 17 (RSP10661)
  18. 0.311 Jiangji (RSP10653)
  19. 0.309 KYRG-11 (RSP11051)
  20. 0.307 Cherry (RSP11142)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4451145
Overlapping SNPs:

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495279
Overlapping SNPs:

Blockchain Registration Information

Transaction ID
Stamping Certificate
Download PDF (866.8 KB)
QR code for RSP11243

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings