R3in134

SRR 14708218

Grower: Lanzhou University, Guangpeng Ren

General Information

Sample Name
NEB4
Accession Date
May 31, 2021
Reported Plant Sex
unknown

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Rare
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type I

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.44%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0228
male female SRR14708218

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

THCAS c.1444C>G p.Leu482Val missense variant moderate contig741 4416384

IGV: Start, Jump

G/C
NGS:
0.000
C90:
0.000
THCAS c.373G>C p.Val125Leu missense variant moderate contig741 4417455

IGV: Start, Jump

C/G
NGS:
0.050
C90:
0.000

Variants (Select Genes of Interest)

GPPs1

UniProt

c.472T>A p.Leu158Met missense variant moderate contig676 168721

IGV: Start, Jump

T/A
NGS:
0.020
C90:
0.000
GPPs1

UniProt

c.744C>G p.Asp248Glu missense variant moderate contig676 168993

IGV: Start, Jump

C/G
NGS:
0.022
C90:
0.000
GPPs1

UniProt

c.807_814delGCATTTTT p.His270fs frameshift variant high contig676 169595

IGV: Start, Jump

GTGCATTTT/G
NGS:
0.015
C90:
0.000
GPPs1

UniProt

c.845_848delAAAG p.Glu282fs frameshift variant high contig676 169629

IGV: Start, Jump

TGAAA/T
NGS:
0.118
C90:
0.000
GPPs1

UniProt

c.857_864delCGAAAGAG p.Ala286fs frameshift variant high contig676 169645

IGV: Start, Jump

GGCGAAAGA/G
NGS:
0.009
C90:
0.000
GPPs1

UniProt

c.866_877delTACTAGAGCTAG p.Leu289_Glu293delinsTer stop gained & disruptive inframe deletion high contig676 169655

IGV: Start, Jump

TTACTAGAGCTAG/T
NGS:
0.009
C90:
0.000
GPPs1

UniProt

c.896A>G p.Asn299Ser missense variant moderate contig676 169772

IGV: Start, Jump

A/G
NGS:
0.046
C90:
0.000
GPPs1

UniProt

c.923_927+5delTTTTGGTACT p.Val308fs frameshift variant & splice donor variant & splice region variant & intron variant high contig676 169798

IGV: Start, Jump

GTTTTGGTACT/G
NGS:
0.009
C90:
0.000
EMF1-2

UniProt

c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

A/C
NGS:
0.090
C90:
0.474
EMF1-2

UniProt

c.1148C>T p.Ala383Val missense variant moderate contig885 2034

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1187T>C p.Leu396Ser missense variant moderate contig885 2073

IGV: Start, Jump

T/C
NGS:
0.026
C90:
0.000
EMF1-2

UniProt

c.1189G>A p.Ala397Thr missense variant moderate contig885 2075

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1199G>A p.Arg400Lys missense variant moderate contig885 2085

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1409G>A p.Arg470Lys missense variant moderate contig885 2295

IGV: Start, Jump

G/A
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.1828A>G p.Ile610Val missense variant moderate contig885 2714

IGV: Start, Jump

A/G
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.2008C>T p.Pro670Ser missense variant moderate contig885 2894

IGV: Start, Jump

C/T
NGS:
0.007
C90:
0.000
EMF1-2

UniProt

c.2653A>G p.Thr885Ala missense variant moderate contig885 3539

IGV: Start, Jump

A/G
NGS:
0.007
C90:
0.000
PHL-2 c.280T>C p.Phe94Leu missense variant moderate contig2621 338845

IGV: Start, Jump

T/C
NGS:
0.000
C90:
0.000
PHL-2 c.722G>A p.Gly241Glu missense variant moderate contig2621 339860

IGV: Start, Jump

G/A
NGS:
0.002
C90:
0.000
PHL-2 c.2564T>A p.Phe855Tyr missense variant moderate contig2621 342607

IGV: Start, Jump

T/A
NGS:
0.064
C90:
0.732
PHL-2 c.2578T>A p.Leu860Ile missense variant moderate contig2621 342621

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.746
PHL-2 c.2834A>G p.Asn945Ser missense variant moderate contig2621 342877

IGV: Start, Jump

A/G
NGS:
0.004
C90:
0.000
PKSG-4b

UniProt

c.558-1G>A splice acceptor variant & intron variant high contig700 2715037

IGV: Start, Jump

C/T
NGS:
0.009
C90:
0.000
PKSG-4b

UniProt

c.323A>G p.Glu108Gly missense variant moderate contig700 2721350

IGV: Start, Jump

T/C
NGS:
0.469
C90:
0.000
PKSG-2a

UniProt

c.241G>A p.Val81Met missense variant moderate contig700 1945149

IGV: Start, Jump

C/T
NGS:
0.136
C90:
0.000
PKSG-2a

UniProt

c.240T>G p.Asp80Glu missense variant moderate contig700 1945150

IGV: Start, Jump

A/C
NGS:
0.136
C90:
0.000
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2a

UniProt

c.-2_1delATA p.Met1del start lost & conservative inframe deletion high contig700 1945632

IGV: Start, Jump

ATAT/A
NGS:
0.009
C90:
0.000
AAE1-1

UniProt

c.1481C>T p.Ala494Val missense variant moderate contig606 3242790

IGV: Start, Jump

G/A
NGS:
0.002
C90:
0.000
AAE1-1

UniProt

c.454A>G p.Lys152Glu missense variant moderate contig606 3243817

IGV: Start, Jump

T/C
NGS:
0.007
C90:
0.000
ELF3

UniProt

c.365A>T p.Lys122Met missense variant moderate contig97 242071

IGV: Start, Jump

A/T
NGS:
0.000
C90:
0.000
ELF3

UniProt

c.499T>G p.Tyr167Asp missense variant moderate contig97 242205

IGV: Start, Jump

T/G
NGS:
0.000
C90:
0.000
ELF3

UniProt

c.574A>G p.Asn192Asp missense variant moderate contig97 242280

IGV: Start, Jump

A/G
NGS:
0.042
C90:
0.579
ELF3

UniProt

c.772A>G p.Ser258Gly missense variant moderate contig97 242478

IGV: Start, Jump

A/G
NGS:
0.112
C90:
0.000
ELF3

UniProt

c.812G>C p.Gly271Ala missense variant moderate contig97 242518

IGV: Start, Jump

G/C
NGS:
0.114
C90:
0.938
ELF3

UniProt

c.1366T>G p.Leu456Val missense variant moderate contig97 244197

IGV: Start, Jump

T/G
NGS:
0.015
C90:
0.000
ELF3

UniProt

c.1466G>A p.Ser489Asn missense variant moderate contig97 244297

IGV: Start, Jump

G/A
NGS:
0.123
C90:
0.000
ELF3

UniProt

c.1966C>G p.Pro656Ala missense variant moderate contig97 244797

IGV: Start, Jump

C/G
NGS:
0.123
C90:
0.632
ELF3

UniProt

c.2156T>G p.Ile719Arg missense variant moderate contig97 244987

IGV: Start, Jump

T/G
NGS:
0.000
C90:
0.000
aPT1

UniProt

c.727G>T p.Glu243* stop gained high contig121 2841362

IGV: Start, Jump

G/T
NGS:
0.127
C90:
0.100
aPT1

UniProt

c.938C>T p.Thr313Ile missense variant moderate contig121 2842584

IGV: Start, Jump

C/T
NGS:
0.000
C90:
0.000
aPT1

UniProt

c.958G>A p.Gly320Ser missense variant moderate contig121 2842731

IGV: Start, Jump

G/A
NGS:
0.004
C90:
0.000
AAE1-2

UniProt

c.331A>G p.Asn111Asp missense variant moderate contig81 209293

IGV: Start, Jump

A/G
NGS:
0.123
C90:
0.000
AAE1-2

UniProt

c.384G>C p.Glu128Asp missense variant moderate contig81 209346

IGV: Start, Jump

G/C
NGS:
0.000
C90:
0.000
AAE1-2

UniProt

c.688G>A p.Asp230Asn missense variant moderate contig81 209650

IGV: Start, Jump

G/A
NGS:
0.018
C90:
0.000
AAE1-2

UniProt

c.1006A>G p.Lys336Glu missense variant moderate contig81 209968

IGV: Start, Jump

A/G
NGS:
0.116
C90:
0.000
AAE1-2

UniProt

c.1102C>A p.His368Asn missense variant moderate contig81 210064

IGV: Start, Jump

C/A
NGS:
0.033
C90:
0.000
AAE1-2

UniProt

c.1118C>G p.Thr373Ser missense variant moderate contig81 210080

IGV: Start, Jump

C/G
NGS:
0.026
C90:
0.000
AAE1-2

UniProt

c.1415G>A p.Ser472Asn missense variant moderate contig81 210377

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1417A>G p.Thr473Ala missense variant moderate contig81 210379

IGV: Start, Jump

A/G
NGS:
0.070
C90:
0.000
AAE1-2

UniProt

c.1434G>T p.Glu478Asp missense variant moderate contig81 210396

IGV: Start, Jump

G/T
NGS:
0.075
C90:
0.000
AAE1-2

UniProt

c.1541T>C p.Val514Ala missense variant moderate contig81 210503

IGV: Start, Jump

T/C
NGS:
0.050
C90:
0.000
PHL-1

UniProt

c.2551A>G p.Thr851Ala missense variant moderate contig1439 1487246

IGV: Start, Jump

T/C
NGS:
0.116
C90:
0.890
PKSG-2b

UniProt

c.1152T>A p.Asn384Lys missense variant moderate contig700 1950486

IGV: Start, Jump

A/T
NGS:
0.715
C90:
0.895
PKSG-2b

UniProt

c.948T>G p.Asp316Glu missense variant moderate contig700 1950690

IGV: Start, Jump

A/C
NGS:
0.456
C90:
0.000
PKSG-2b

UniProt

c.945T>G p.Ser315Arg missense variant moderate contig700 1950693

IGV: Start, Jump

A/C
NGS:
0.454
C90:
0.000
PKSG-2b

UniProt

c.944G>A p.Ser315Asn missense variant moderate contig700 1950694

IGV: Start, Jump

C/T
NGS:
0.445
C90:
0.000
PKSG-2b

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1950704

IGV: Start, Jump

G/C
NGS:
0.410
C90:
0.000
PKSG-2b

UniProt

c.-2_1dupATA start lost & conservative inframe insertion high contig700 1951880

IGV: Start, Jump

A/ATAT
NGS:
0.410
C90:
0.000
TFL1

UniProt

c.302-1G>A splice acceptor variant & intron variant high contig1636 520616

IGV: Start, Jump

C/T
NGS:
0.103
C90:
0.794
HDS-1

UniProt

c.136G>A p.Val46Ile missense variant moderate contig1891 889256

IGV: Start, Jump

C/T
NGS:
0.088
C90:
0.593
HDS-1

UniProt

c.56C>G p.Ala19Gly missense variant moderate contig1891 889336

IGV: Start, Jump

G/C
NGS:
0.125
C90:
0.943
HDS-1

UniProt

c.-108+1_-108+2insG splice donor variant & intron variant high contig1891 889975

IGV: Start, Jump

A/AC
NGS:
0.217
C90:
0.000
PIE1-2

UniProt

c.5932A>G p.Ile1978Val missense variant moderate contig1460 1185552

IGV: Start, Jump

T/C
NGS:
0.061
C90:
0.268
PIE1-2

UniProt

c.1872T>A p.Asp624Glu missense variant moderate contig1460 1190252

IGV: Start, Jump

A/T
NGS:
0.086
C90:
0.990
PIE1-2

UniProt

c.710C>T p.Pro237Leu missense variant moderate contig1460 1193804

IGV: Start, Jump

G/A
NGS:
0.072
C90:
0.866
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
EMF1-1

UniProt

c.62C>G p.Thr21Ser missense variant moderate contig883 268910

IGV: Start, Jump

C/G
NGS:
0.007
C90:
0.000
EMF1-1

UniProt

c.590A>T p.Lys197Ile missense variant moderate contig883 270079

IGV: Start, Jump

A/T
NGS:
0.007
C90:
0.000
FT

UniProt

c.173_181delTTCTCAACC p.Leu58_Asn60del disruptive inframe deletion moderate contig1561 3124595

IGV: Start, Jump

ACTTCTCAAC/A
NGS:
0.000
C90:
0.000
FT

UniProt

c.240C>G p.Asn80Lys missense variant moderate contig1561 3124664

IGV: Start, Jump

C/G
NGS:
0.075
C90:
0.000
FT

UniProt

c.259+1_259+2insTA splice donor variant & intron variant high contig1561 3124684

IGV: Start, Jump

G/GTA
NGS:
0.015
C90:
0.077
FT

UniProt

c.364A>G p.Ile122Val missense variant moderate contig1561 3126401

IGV: Start, Jump

A/G
NGS:
0.000
C90:
0.000
FT

UniProt

c.421_422dupTA p.Leu142fs frameshift variant high contig1561 3126659

IGV: Start, Jump

C/CTA
NGS:
0.000
C90:
0.000
FT

UniProt

c.424C>A p.Leu142Ile missense variant moderate contig1561 3126663

IGV: Start, Jump

C/A
NGS:
0.000
C90:
0.000
aPT4

UniProt

c.80A>G p.Lys27Arg missense variant moderate contig121 2828736

IGV: Start, Jump

A/G
NGS:
0.061
C90:
0.000
aPT4

UniProt

c.202T>A p.Leu68Ile missense variant moderate contig121 2828858

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
aPT4

UniProt

c.916C>T p.His306Tyr missense variant & splice region variant moderate contig121 2832711

IGV: Start, Jump

C/T
NGS:
0.015
C90:
0.000
aPT4

UniProt

c.1168T>C p.Tyr390His missense variant moderate contig121 2833503

IGV: Start, Jump

T/C
NGS:
0.546
C90:
0.000
FLD

UniProt

c.2869C>T p.His957Tyr missense variant moderate contig1450 2044163

IGV: Start, Jump

G/A
NGS:
0.011
C90:
0.000
FLD

UniProt

c.2831A>G p.Glu944Gly missense variant moderate contig1450 2044201

IGV: Start, Jump

T/C
NGS:
0.011
C90:
0.000
FLD

UniProt

c.2069G>A p.Arg690Gln missense variant moderate contig1450 2045671

IGV: Start, Jump

C/T
NGS:
0.000
C90:
0.000
AAE1-3

UniProt

c.695C>T p.Thr232Ile missense variant moderate contig976 1083159

IGV: Start, Jump

G/A
NGS:
0.000
C90:
0.000
AAE1-3

UniProt

c.634G>C p.Gly212Arg missense variant moderate contig976 1083220

IGV: Start, Jump

C/G
NGS:
0.116
C90:
0.000
AAE1-3

UniProt

c.586-28_608delGACACCTTGTGCGTTCATTAATGTGAAGAGTGATGCTAATGTCAGTGGTGA p.Ser196fs frameshift variant & splice acceptor variant & splice region variant & intron variant high contig976 1083245

IGV: Start, Jump

ATCACCACTGACATTAGCATCACTCTTCACATTAATGAACGCACAAGGTGTC/A
NGS:
0.000
C90:
0.000
AAE1-3

UniProt

c.382T>C p.Tyr128His missense variant moderate contig976 1083643

IGV: Start, Jump

A/G
NGS:
0.072
C90:
0.000
AAE1-3

UniProt

c.338_339delCT p.Pro113fs frameshift variant high contig976 1083685

IGV: Start, Jump

TAG/T
NGS:
0.000
C90:
0.000
AAE1-3

UniProt

c.8C>T p.Ser3Leu missense variant moderate contig976 1084067

IGV: Start, Jump

G/A
NGS:
0.000
C90:
0.000
AAE1-3

UniProt

c.3G>A p.Met1? start lost high contig976 1084072

IGV: Start, Jump

C/T
NGS:
0.046
C90:
0.416
GGR

UniProt

c.317C>T p.Pro106Leu missense variant moderate contig2282 549309

IGV: Start, Jump

C/T
NGS:
0.035
C90:
0.220
GGR

UniProt

c.456T>A p.His152Gln missense variant moderate contig2282 549448

IGV: Start, Jump

T/A
NGS:
0.068
C90:
0.000
GGR

UniProt

c.460G>A p.Asp154Asn missense variant moderate contig2282 549452

IGV: Start, Jump

G/A
NGS:
0.070
C90:
0.000
GGR

UniProt

c.704A>T p.His235Leu missense variant moderate contig2282 549696

IGV: Start, Jump

A/T
NGS:
0.121
C90:
0.000

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8349269
Overlapping SNPs:
12
Concordance:
10

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495181
Overlapping SNPs:
3
Concordance:
3
QR code for SRR14708218

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings