KYRG-151

RSP 11052

Grower: Landrace kyrgyzstan

General Information

Sample Name
Kyrgyz-MS
Accession Date
February 5, 2018
Reported Plant Sex
not reported

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Uncommon
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type II

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.24%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0594
male female RSP11052

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

No variants to report

Variants (Select Genes of Interest)

PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2b

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1951851

IGV: Start, Jump

T/A
NGS:
0.844
C90:
0.880
PKSG-4b

UniProt

c.535_545delATTGGAGTGGG p.Ile179fs frameshift variant high contig700 2721127

IGV: Start, Jump

CCCCACTCCAAT/C
NGS:
0.105
C90:
0.000
PKSG-4b

UniProt

c.523C>T p.His175Tyr missense variant moderate contig700 2721150

IGV: Start, Jump

G/A
NGS:
0.112
C90:
0.325
PKSG-4b

UniProt

c.509_510insTAAAAATTAACCCAAATTTCAATATTTTTGTAAGTTTCCC p.Glu172fs frameshift variant & stop gained high contig700 2721163

IGV: Start, Jump

T/TGGGAAACTTACAAAAATATTGAAATTTGGGTTAATTTTTA
NGS:
0.002
C90:
0.000
PKSG-4b

UniProt

c.496A>G p.Lys166Glu missense variant moderate contig700 2721177

IGV: Start, Jump

T/C
NGS:
0.651
C90:
0.684
PKSG-4b

UniProt

c.489delT p.Phe163fs frameshift variant high contig700 2721183

IGV: Start, Jump

CA/C
NGS:
0.792
C90:
0.761
PKSG-4b

UniProt

c.485A>G p.Lys162Arg missense variant moderate contig700 2721188

IGV: Start, Jump

T/C
NGS:
0.643
C90:
0.301
aPT4

UniProt

c.474_475insTATGAAACA p.Cys158_Thr159insTyrGluThr conservative inframe insertion moderate contig121 2830669

IGV: Start, Jump

T/TTATGAAACA
NGS:
0.002
C90:
0.000
aPT4

UniProt

c.517A>T p.Ile173Leu missense variant & splice region variant moderate contig121 2830795

IGV: Start, Jump

A/T
NGS:
0.022
C90:
0.000
aPT1

UniProt

c.629C>T p.Thr210Ile missense variant moderate contig121 2840237

IGV: Start, Jump

C/T
NGS:
0.561
C90:
0.598

Nearest genetic relatives (All Samples)

0 0.058 0.117 0.175 0.233
clone distance sibling distance more distant
  1. 0.187 Fedora 17 (RSP10661)
  2. 0.187 Kyrgyz Gold (RSP11054)
  3. 0.191 Santhica 27 (RSP10665)
  4. 0.196 KYRG-21 (RSP11053)
  5. 0.203 Tisza (RSP10659)
  6. 0.204 Lovrin (RSP10658)
  7. 0.207 Jiangji (RSP10653)
  8. 0.209 Tisza (RSP11044)
  9. 0.212 Tisza (RSP11045)
  10. 0.213 USO 31 (RSP10983)
  11. 0.213 USO 31 (RSP10981)
  12. 0.214 KYRG-11 (RSP11051)
  13. 0.215 Futura 75 (RSP10664)
  14. 0.215 Fedora 17 (RSP11203)
  15. 0.217 Monoica (RSP10241)
  16. 0.217 Santhica27 (RSP10056)
  17. 0.219 Tygra (RSP10667)
  18. 0.220 Santhica27 (RSP11046)
  19. 0.225 Santhica27 (RSP11047)
  20. 0.227 Carmagnola USO 31 (RSP11204)

Nearest genetic relatives (Base Tree)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.192 Kyrgyz Gold (RSP11054)
  2. 0.193 Fedora 17 (RSP10661)
  3. 0.207 Tisza (RSP10659)
  4. 0.210 Lovrin (RSP10658)
  5. 0.211 Tisza (RSP11044)
  6. 0.214 KYRG-11 (RSP11051)
  7. 0.217 Jiangji (RSP10653)
  8. 0.224 USO 31 (RSP10981)
  9. 0.225 Monoica (RSP10241)
  10. 0.227 Futura 75 (RSP10664)
  11. 0.230 Tygra (RSP10667)
  12. 0.233 Santhica27 (RSP11047)
  13. 0.242 Feral (RSP10890)
  14. 0.243 Ivory (RSP10668)
  15. 0.243 Kimbo Slice (RSP10997)
  16. 0.247 Recon (RSP10755)
  17. 0.248 Carmagnola (RSP10979)
  18. 0.249 Blueberry Cheesecake (RSP10684)
  19. 0.254 Carmagnola (RSP11037)
  20. 0.259 RKM-2018-029 (RSP11121)

Most genetically distant strains (All Samples)

0 0.117 0.233 0.350 0.467
clone distance sibling distance more distant
  1. 0.437 Cherry Blossom (RSP11318)
  2. 0.430 Cherry Blossom (RSP11323)
  3. 0.417 Cherry Blossom (RSP11300)
  4. 0.403 Cherry Blossom (RSP11312)
  5. 0.401 Cherry Blossom (RSP11301)
  6. 0.398 Unknown- Cherry Wine - 001 (RSP11268)
  7. 0.397 Cherry Blossom (RSP11325)
  8. 0.395 Cherry Blossom (RSP11306)
  9. 0.392 Cherry Blossom (RSP11328)
  10. 0.391 Cherry Blossom (RSP11311)
  11. 0.388 Unknown- Cherry Wine - 002 (RSP11269)
  12. 0.385 Cherry Blossom (RSP11322)
  13. 0.385 Cherry Blossom (RSP11333)
  14. 0.382 Cherry Blossom (RSP11298)
  15. 0.381 Cherry Blossom (RSP11274)
  16. 0.379 Cherry Blossom (RSP11308)
  17. 0.379 Cherry Blossom (RSP11334)
  18. 0.378 Unknown- Cherry Wine - 003 (RSP11270)
  19. 0.378 Cherry Blossom (RSP11309)
  20. 0.377 Cherry Blossom (RSP11331)

Most genetically distant strains (Base Tree)

0 0.100 0.200 0.300 0.400
clone distance sibling distance more distant
  1. 0.371 Cbot-2019-005 (RSP11133)
  2. 0.347 JL yellow (RSP11075)
  3. 0.338 Kush Hemp E1 (RSP11128)
  4. 0.334 RKM-2018-002 (RSP11093)
  5. 0.332 RKM-2018-028 (RSP11120)
  6. 0.324 RKM-2018-022 (RSP11114)
  7. 0.322 RKM-2018-006 (RSP11097)
  8. 0.319 Cbot-2019-004 (RSP11132)
  9. 0.319 RKM-2018-023 (RSP11115)
  10. 0.315 Skunk 18 (RSP11038)
  11. 0.314 RKM-2018-032 (RSP11124)
  12. 0.313 Blue Dream (RSP11033)
  13. 0.312 RKM-2018-018 (RSP11110)
  14. 0.312 Cbot-2019-001 (RSP11129)
  15. 0.307 UP Sunrise (RSP10989)
  16. 0.307 Cherry (RSP11142)
  17. 0.306 Blueberry Cheesecake (RSP10672)
  18. 0.305 RKM-2018-019 (RSP11111)
  19. 0.304 RKM-2018-003 (RSP11094)
  20. 0.302 RKM-2018-005 (RSP11096)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR4448770
Overlapping SNPs:
90
Concordance:
66

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495250
Overlapping SNPs:
2
Concordance:
2

Blockchain Registration Information

Transaction ID
7ab16af94390316560b5d05b5c9a3dcc97f63d890786d84195141b601d3df41b
Stamping Certificate
Download PDF (858.6 KB)
SHASUM Hash
e0e0a21f8b35628034519e87d379664ffc6c30cf7663426d5a6953928b75e85a
QR code for RSP11052

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings