Kompolti

SRR 14708277

Grower: Lanzhou University, Guangpeng Ren

General Information

Sample Name
HKI
Accession Date
May 31, 2021
Reported Plant Sex
not reported

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Common
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type II

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.5%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0237
male female SRR14708277

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

No variants to report

Variants (Select Genes of Interest)

EMF1-2

UniProt

c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

A/C
NGS:
0.090
C90:
0.474
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-2a

UniProt

c.944G>A p.Ser315Asn missense variant moderate contig700 1944446

IGV: Start, Jump

C/T
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1944456

IGV: Start, Jump

G/C
NGS:
0.070
C90:
0.000
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2a

UniProt

c.-22_2delTAAAAATTATAATAATAATAATAT p.Met1del start lost & conservative inframe deletion high contig700 1945631

IGV: Start, Jump

CATATTATTATTATTATAATTTTTA/C
NGS:
0.013
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
aPT1

UniProt

c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump

A/G
NGS:
0.579
C90:
0.761
aPT1

UniProt

c.574A>T p.Met192Leu missense variant moderate contig121 2840182

IGV: Start, Jump

A/T
NGS:
0.024
C90:
0.000
aPT1

UniProt

c.629C>T p.Thr210Ile missense variant moderate contig121 2840237

IGV: Start, Jump

C/T
NGS:
0.561
C90:
0.598
aPT1

UniProt

c.727G>T p.Glu243* stop gained high contig121 2841362

IGV: Start, Jump

G/T
NGS:
0.127
C90:
0.100
PKSG-2b

UniProt

c.1136G>A p.Arg379His missense variant moderate contig700 1950502

IGV: Start, Jump

C/T
NGS:
0.002
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
EMF2

UniProt

c.722C>T p.Thr241Ile missense variant moderate contig954 3050302

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.062
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
FT

UniProt

c.240C>G p.Asn80Lys missense variant moderate contig1561 3124664

IGV: Start, Jump

C/G
NGS:
0.075
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.198A>C p.Lys66Asn missense variant moderate contig121 2828854

IGV: Start, Jump

A/C
NGS:
0.044
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
AAE1-3

UniProt

c.475G>A p.Gly159Arg missense variant moderate contig976 1083550

IGV: Start, Jump

C/T
NGS:
0.048
C90:
0.000
PKSB-3

UniProt

c.1490C>T p.Ala497Val missense variant moderate contig93 3339597

IGV: Start, Jump

C/T
NGS:
0.011
C90:
0.000

Nearest genetic relatives (All Samples)

0 0.033 0.067 0.100 0.133
clone distance sibling distance more distant
  1. 0.070 AOAC MI 545 (RSP11756)
  2. 0.071 AOAC MI 542 (RSP11755)
  3. 0.077 AOAC MI 569 (RSP11759)
  4. 0.078 AOAC MI 508 (RSP11750)
  5. 0.083 AOAC MI 599 (RSP11762)
  6. 0.085 AOAC MI 504 (RSP11749)
  7. 0.085 AOAC MI 533 (RSP11753)
  8. 0.090 AOAC MI 588 (RSP11760)
  9. 0.090 AOAC MI 567 (RSP11758)
  10. 0.092 AOAC MI 535 (RSP11754)
  11. 0.092 AOAC MI 597 (RSP11761)
  12. 0.094 AOAC MI 501 (RSP11748)
  13. 0.095 AOAC MI 532 (RSP11752)
  14. 0.098 AOAC MI 548 (RSP11757)
  15. 0.103 Blue Dream (RSP11010)
  16. 0.103 Super Blue Dream (RSP11011)
  17. 0.106 Electra (RSP11366)
  18. 0.115 Blue Dream (RSP11004)
  19. 0.115 Rest (RSP11377)
  20. 0.115 Lift (RSP11378)

Nearest genetic relatives (Base Tree)

0 0.067 0.133 0.200 0.267
clone distance sibling distance more distant
  1. 0.159 Liberty Haze (RSP11000)
  2. 0.182 Futura 75 (RSP10664)
  3. 0.189 Blueberry Cheesecake (RSP10684)
  4. 0.203 Hermaphrodite ResearchSample2 (RSP11050)
  5. 0.204 RKM-2018-003 (RSP11094)
  6. 0.210 Tygra (RSP10667)
  7. 0.211 Durban Poison (RSP11014)
  8. 0.213 Recon (RSP10755)
  9. 0.219 KYRG-11 (RSP11051)
  10. 0.220 Lovrin (RSP10658)
  11. 0.223 RKM-2018-019 (RSP11111)
  12. 0.227 Italian Kiss (RSP11034)
  13. 0.227 UP Sunrise (RSP10989)
  14. 0.231 Carmagnola (RSP11037)
  15. 0.232 Santhica27 (RSP11047)
  16. 0.235 Cbot-2019-004 (RSP11132)
  17. 0.235 Tisza (RSP11044)
  18. 0.236 Cbot-2019-001 (RSP11129)
  19. 0.236 Cherry (RSP11142)
  20. 0.239 Tisza (RSP10659)

Most genetically distant strains (All Samples)

0 0.108 0.217 0.325 0.433
clone distance sibling distance more distant
  1. 0.424 JL 4th Gen 5 (RSP11199)
  2. 0.423 JL yellow (RSP11075)
  3. 0.402 JL 4th Gen 6 (RSP11200)
  4. 0.397 80E (RSP11213)
  5. 0.387 JL 3rd Gen Mother (RSP11197)
  6. 0.379 JL 3rd Gen Mother (RSP11214)
  7. 0.377 JL 4th Gen 1 (RSP11193)
  8. 0.373 JL 4th Gen 2 (RSP11194)
  9. 0.362 Tiger Tail 30 (RSP11484)
  10. 0.360 JL 3rd Gen Father (RSP11196)
  11. 0.353 Tanao Sri 46 (RSP11486)
  12. 0.352 Danny Noonan (RSP11070)
  13. 0.350 JL 4th Gen 4 (RSP11198)
  14. 0.349 Tanao Sri-white 80 (RSP11621)
  15. 0.348 80E (RSP11212)
  16. 0.347 Feral (RSP11205)
  17. 0.345 Unknown- Cherry Wine - 001 (RSP11268)
  18. 0.343 JL 2 (RSP11076)
  19. 0.338 80E (RSP11211)
  20. 0.336 Chematonic Cannatonic x Chemdawg (RSP11394)

Most genetically distant strains (Base Tree)

0 0.108 0.217 0.325 0.433
clone distance sibling distance more distant
  1. 0.414 JL yellow (RSP11075)
  2. 0.325 Kush Hemp E1 (RSP11128)
  3. 0.312 RKM-2018-026 (RSP11118)
  4. 0.301 Blueberry Cheesecake (RSP10672)
  5. 0.299 Skywalker OG (RSP10837)
  6. 0.298 The Gift (RSP10988)
  7. 0.295 Sour Raspberry (RSP10551)
  8. 0.290 RKM-2018-033 (RSP11125)
  9. 0.286 Feral (RSP10890)
  10. 0.282 RKM-2018-006 (RSP11097)
  11. 0.282 RKM-2018-034 (RSP11126)
  12. 0.282 RKM-2018-029 (RSP11121)
  13. 0.282 Ivory (RSP10668)
  14. 0.281 Cbot-2019-006 (RSP11134)
  15. 0.279 Black Beauty (RSP11035)
  16. 0.279 Skunk 18 (RSP11038)
  17. 0.278 Cbot-2019-005 (RSP11133)
  18. 0.275 Fedora 17 (RSP10661)
  19. 0.274 RKM-2018-022 (RSP11114)
  20. 0.273 Pie Hoe (RSP11073)

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8349377
Overlapping SNPs:
11
Concordance:
10

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495238
Overlapping SNPs:
4
Concordance:
4
QR code for SRR14708277

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings