Kompolti

SRR 14708277

Grower: Lanzhou University, Guangpeng Ren

General Information

Sample Name
HKI
Accession Date
May 31, 2021
Reported Plant Sex
unknown

The strain rarity visualization shows how distant the strain is from the other cultivars in the Kannapedia database. The y-axis represents genetic distance, getting farther as you go up. The width of the visualization at any position along the y-axis shows how many strains there are in the database at that genetic distance. So, a common strain will have a more bottom-heavy shape, while uncommon and rare cultivars will have a visualization that is generally shifted towards the top.

Rarity: Common
Most Distant Most Similar

Chemical Information

Cannabinoid and terpenoid information provided by the grower.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Genetic Information

Plant Type
Type II

The bell curve in the heterozygosity visualization shows the distribution of heterozygosity levels for cannabis cultivars in the Kannapedia database. The green line shows where this particular strain fits within the distribution. Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.5%
Least Heterozygous Most Heterozygous

The ratio of reads mapped to Y-contigs to reads mapped to the whole Cannabis genome (Y-ratios) has been demonstrated to be strongly correlated with plant sex typing. This plot shows the distribution of Y-ratios for all samples in our database which were sequenced with the same method (panel or WGS) as this sample and where this sample falls in the distribution.

Y-Ratio Distribution: 0.0237
male female SRR14708277

This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).

Bt/Bd Allele Coverage

This chart represents the Illumina sequence coverage over the CBCA synthase gene.

CBCAS Coverage

Variants (THCAS, CBDAS, and CBCAS)

No variants to report

Variants (Select Genes of Interest)

EMF1-2

UniProt

c.710A>C p.His237Pro missense variant moderate contig885 810

IGV: Start, Jump

A/C
NGS:
0.090
C90:
0.474
PKSG-4b

UniProt

c.431T>G p.Val144Gly missense variant moderate contig700 2721242

IGV: Start, Jump

A/C
NGS:
0.575
C90:
0.679
PKSG-2a

UniProt

c.944G>A p.Ser315Asn missense variant moderate contig700 1944446

IGV: Start, Jump

C/T
NGS:
0.079
C90:
0.000
PKSG-2a

UniProt

c.934C>G p.His312Asp missense variant moderate contig700 1944456

IGV: Start, Jump

G/C
NGS:
0.070
C90:
0.000
PKSG-2a

UniProt

c.67T>A p.Phe23Ile missense variant moderate contig700 1945567

IGV: Start, Jump

A/T
NGS:
0.825
C90:
0.904
PKSG-2a

UniProt

c.31A>T p.Thr11Ser missense variant moderate contig700 1945603

IGV: Start, Jump

T/A
NGS:
0.763
C90:
0.876
PKSG-2a

UniProt

c.-22_2delTAAAAATTATAATAATAATAATAT p.Met1del start lost & conservative inframe deletion high contig700 1945631

IGV: Start, Jump

CATATTATTATTATTATAATTTTTA/C
NGS:
0.013
C90:
0.000
DXR-2

UniProt

c.1319T>C p.Ile440Thr missense variant moderate contig380 285250

IGV: Start, Jump

A/G
NGS:
0.480
C90:
0.000
aPT1

UniProt

c.406A>G p.Ile136Val missense variant moderate contig121 2839605

IGV: Start, Jump

A/G
NGS:
0.579
C90:
0.761
aPT1

UniProt

c.574A>T p.Met192Leu missense variant moderate contig121 2840182

IGV: Start, Jump

A/T
NGS:
0.024
C90:
0.000
aPT1

UniProt

c.629C>T p.Thr210Ile missense variant moderate contig121 2840237

IGV: Start, Jump

C/T
NGS:
0.561
C90:
0.598
aPT1

UniProt

c.727G>T p.Glu243* stop gained high contig121 2841362

IGV: Start, Jump

G/T
NGS:
0.127
C90:
0.100
PKSG-2b

UniProt

c.1136G>A p.Arg379His missense variant moderate contig700 1950502

IGV: Start, Jump

C/T
NGS:
0.002
C90:
0.000
PKSG-2b

UniProt

c.1117A>G p.Ile373Val missense variant moderate contig700 1950521

IGV: Start, Jump

T/C
NGS:
0.807
C90:
0.981
EMF2

UniProt

c.722C>T p.Thr241Ile missense variant moderate contig954 3050302

IGV: Start, Jump

C/T
NGS:
0.018
C90:
0.062
EMF2

UniProt

c.1772A>G p.Gln591Arg missense variant moderate contig954 3059929

IGV: Start, Jump

A/G
NGS:
0.092
C90:
0.876
FT

UniProt

c.240C>G p.Asn80Lys missense variant moderate contig1561 3124664

IGV: Start, Jump

C/G
NGS:
0.075
C90:
0.000
aPT4

UniProt

c.153A>C p.Lys51Asn missense variant moderate contig121 2828809

IGV: Start, Jump

A/C
NGS:
0.375
C90:
0.000
aPT4

UniProt

c.198A>C p.Lys66Asn missense variant moderate contig121 2828854

IGV: Start, Jump

A/C
NGS:
0.044
C90:
0.000
aPT4

UniProt

c.235_236delGT p.Val79fs frameshift variant high contig121 2829030

IGV: Start, Jump

ATG/A
NGS:
0.417
C90:
0.000
aPT4

UniProt

c.238delT p.Ser80fs frameshift variant high contig121 2829034

IGV: Start, Jump

AT/A
NGS:
0.421
C90:
0.000
AAE1-3

UniProt

c.475G>A p.Gly159Arg missense variant moderate contig976 1083550

IGV: Start, Jump

C/T
NGS:
0.048
C90:
0.000
PKSB-3

UniProt

c.1490C>T p.Ala497Val missense variant moderate contig93 3339597

IGV: Start, Jump

C/T
NGS:
0.011
C90:
0.000

Nearest genetic relative in Phylos dataset

Phylos Strain SRR8349377
Overlapping SNPs:
11
Concordance:
10

Nearest genetic relative in Lynch dataset

Lynch Strain SRR3495238
Overlapping SNPs:
4
Concordance:
4
QR code for SRR14708277

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings