Tisza

RSP11044
StrainSEEK Cannabis Certification Report

Accession Date:

January 8, 2018

General Information

Strain: Tisza
Sample: Tisza-1
RSP ID: RSP11044
Grower: CSU
Accession Date: January 8, 2018
Gender: Male
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.31
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type II

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
THCASc.187A>Cp.Ile63Leumissense variantMODERATEcontig7414417641

IGV:Start|Jump

T/G

NGS:0.059

C90:0.679

0.059



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
PKSG-2a

UNIPROT

c.948T>Gp.Asp316Glumissense variantMODERATEcontig7001944442

IGV:Start|Jump

A/C

NGS:0.079

C90:0.000

0.079
PKSG-2a

UNIPROT

c.945T>Gp.Ser315Argmissense variantMODERATEcontig7001944445

IGV:Start|Jump

A/C

NGS:0.079

C90:0.000

0.079
PKSG-2a

UNIPROT

c.944G>Ap.Ser315Asnmissense variantMODERATEcontig7001944446

IGV:Start|Jump

C/T

NGS:0.079

C90:0.000

0.079
PKSG-2a

UNIPROT

c.934C>Gp.His312Aspmissense variantMODERATEcontig7001944456

IGV:Start|Jump

G/C

NGS:0.070

C90:0.000

0.07
PKSG-2a

UNIPROT

c.-22_2delTAAAAATTATAATAATAATAATATp.Met1delstart lost&conservative inframe deletionHIGHcontig7001945631

IGV:Start|Jump

CATATTATTATTATTATAATTTTTA/C

NGS:0.013

C90:0.000

0.013
PKSG-2b

UNIPROT

c.945T>Gp.Ser315Argmissense variantMODERATEcontig7001950693

IGV:Start|Jump

A/C

NGS:0.454

C90:0.000

0.454
PKSG-2b

UNIPROT

c.944G>Ap.Ser315Asnmissense variantMODERATEcontig7001950694

IGV:Start|Jump

C/T

NGS:0.445

C90:0.000

0.445
PKSG-2b

UNIPROT

c.934C>Gp.His312Aspmissense variantMODERATEcontig7001950704

IGV:Start|Jump

G/C

NGS:0.410

C90:0.000

0.41
PKSG-2b

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001951851

IGV:Start|Jump

T/A

NGS:0.844

C90:0.880

0.844
PKSG-4b

UNIPROT

c.526T>Cp.Trp176Argmissense variantMODERATEcontig7002721147

IGV:Start|Jump

A/G

NGS:0.037

C90:0.000

0.037
aPT1

UNIPROT

c.160A>Cp.Thr54Promissense variantMODERATEcontig1212835867

IGV:Start|Jump

A/C

NGS:0.086

C90:0.048

0.086
aPT1

UNIPROT

c.670T>Ap.Ser224Thrmissense variantMODERATEcontig1212840278

IGV:Start|Jump

T/A

NGS:0.077

C90:0.000

0.077
aPT1

UNIPROT

c.727G>Tp.Glu243*stop gainedHIGHcontig1212841362

IGV:Start|Jump

G/T

NGS:0.127

C90:0.100

0.127
aPT1

UNIPROT

c.864C>Gp.Asn288Lysmissense variantMODERATEcontig1212842407

IGV:Start|Jump

C/G

NGS:0.075

C90:0.062

0.075
HDS-2

UNIPROT

c.82_93delGTAACCGGAACTp.Val28_Thr31delconservative inframe deletionMODERATEcontig951989748

IGV:Start|Jump

CGTAACCGGAACT/C

NGS:0.805

C90:0.000

0.805


NEAREST GENETIC RELATIVES TO Tisza:
# Relative Genetic Distance
1 RSP11045-Tisza 0.14
2 RSP10978-Carmagnola 5.98
3 RSP10665-Santhica 27 5.98
4 RSP10979-Carmagnola 6.09
5 RSP11210-Tiborszallasie 6.14
6 RSP10976-Carmagnola 6.17
7 RSP10659-Tisza 6.2
8 RSP10664-Futura 75 6.24
9 RSP11052-KYRG-151 6.27
10 RSP11039-Carmagnola 6.29
11 RSP10982-Carmagnola 6.35
12 RSP10235-Diana 6.55
13 RSP11202-Carmagnola 6.57
14 RSP11037-Carmagnola 6.6
15 RSP10056-Santhica27 6.65
16 RSP10667-Tygra 6.67
17 RSP10890-Feral 6.67
18 RSP10891-Feral 6.68
19 RSP10661-Fedora 17 6.71
20 RSP11204-Carmagnola USO 31 6.73
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP10979-Carmagnola 6.16
2 RSP10659-Tisza 6.18
3 RSP10664-Futura 75 6.21
4 RSP10661-Fedora 17 6.52
5 RSP10667-Tygra 6.55
6 RSP11037-Carmagnola 6.57
7 RSP10890-Feral 6.58
8 RSP10241-Monoica 6.76
9 RSP10658-Lovrin 6.86
10 RSP11051-KYRG-11 7.06
11 RSP11047-Santhica27 7.12
12 RSP10981-USO 31 7.18
13 RSP11054-Kyrgyz Gold 7.33
14 RSP10653-Jiangji 7.53
15 RSP10668-Ivory 7.64
16 RSP10755-Recon 8.33
17 RSP11121-RKM-2018-029 8.43
18 RSP10997-Kimbo Slice 8.67
19 RSP10684-Blueberry Cheesecake 9
20 RSP11050-Hermaphrodite ResearchSample2 9.12
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR4448807 113 70

Blockchain Registration Information:

Transaction ID: 321aa23f01f531e522660d4abef1954782ecf9f65e8668330b7bcf96218afbc9
Stamping Certificate: PDF
SHASUM Hash: 95005c68c2c3f576f9b28bd374ab50c1d4dcf49b1cf9904683a84d004aa451da