Cherry Blossom

RSP11315
StrainSEEK Cannabis Certification Report

Accession Date:

October 17, 2019

General Information

Strain: Cherry Blossom
Sample: CD5
RSP ID: RSP11315
Grower: Yabba Cannaba
Accession Date: October 17, 2019
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.46
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
GPPs1

UNIPROT

c.845_848delAAAGp.Glu282fsframeshift variantHIGHcontig676169629

IGV:Start|Jump

TGAAA/T

NGS:0.118

C90:0.000

0.118
PKSG-4a

UNIPROT

c.493G>Ap.Gly165Sermissense variantMODERATEcontig7001937904

IGV:Start|Jump

G/A

NGS:0.103

C90:0.000

0.103
PKSG-4a

UNIPROT

c.1191_1193delTTAp.Tyr398deldisruptive inframe deletionMODERATEcontig7001938600

IGV:Start|Jump

AATT/A

NGS:0.167

C90:0.000

0.167
PKSG-2a

UNIPROT

c.67T>Ap.Phe23Ilemissense variantMODERATEcontig7001945567

IGV:Start|Jump

A/T

NGS:0.825

C90:0.904

0.825
PKSG-2a

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001945603

IGV:Start|Jump

T/A

NGS:0.763

C90:0.876

0.763
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-2b

UNIPROT

c.774G>Ap.Met258Ilemissense variantMODERATEcontig7001950864

IGV:Start|Jump

C/T

NGS:0.366

C90:0.947

0.366
PKSG-2b

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001951851

IGV:Start|Jump

T/A

NGS:0.844

C90:0.880

0.844
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
PKSG-4b

UNIPROT

c.431T>Gp.Val144Glymissense variantMODERATEcontig7002721242

IGV:Start|Jump

A/C

NGS:0.575

C90:0.679

0.575
PKSG-4b

UNIPROT

c.419A>Gp.Asp140Glymissense variantMODERATEcontig7002721254

IGV:Start|Jump

T/C

NGS:0.430

C90:0.440

0.43
PKSG-4b

UNIPROT

c.352_355delACAGp.Thr118fsframeshift variantHIGHcontig7002721317

IGV:Start|Jump

CCTGT/C

NGS:0.529

C90:0.000

0.529
PKSG-4b

UNIPROT

c.324A>Cp.Glu108Aspmissense variantMODERATEcontig7002721349

IGV:Start|Jump

T/G

NGS:0.094

C90:0.000

0.094
PKSG-4b

UNIPROT

c.323A>Gp.Glu108Glymissense variantMODERATEcontig7002721350

IGV:Start|Jump

T/C

NGS:0.469

C90:0.000

0.469
aPT4

UNIPROT

c.97T>Cp.Tyr33Hismissense variantMODERATEcontig1212828753

IGV:Start|Jump

T/C

NGS:0.439

C90:0.000

0.439
aPT4

UNIPROT

c.153A>Cp.Lys51Asnmissense variantMODERATEcontig1212828809

IGV:Start|Jump

A/C

NGS:0.375

C90:0.000

0.375
aPT4

UNIPROT

c.235_236delGTp.Val79fsframeshift variantHIGHcontig1212829030

IGV:Start|Jump

ATG/A

NGS:0.417

C90:0.000

0.417
aPT4

UNIPROT

c.238delTp.Ser80fsframeshift variantHIGHcontig1212829034

IGV:Start|Jump

AT/A

NGS:0.421

C90:0.000

0.421
aPT4

UNIPROT

c.302A>Gp.Asn101Sermissense variantMODERATEcontig1212829099

IGV:Start|Jump

A/G

NGS:0.349

C90:0.000

0.349
aPT4

UNIPROT

c.744+1_744+19delGTAATTTATTTTATTATAAsplice donor variant&splice region variant&intron variantHIGHcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/G

NGS:0.096

C90:0.000

0.096


NEAREST GENETIC RELATIVES TO Cherry Blossom:
# Relative Genetic Distance
1 RSP11325-Cherry Blossom 2.34
2 RSP11306-Cherry Blossom 3.72
3 RSP11329-Cherry Blossom 4.34
4 RSP11299-Cherry Blossom 4.88
5 RSP11327-Cherry Blossom 4.91
6 RSP11272-Unknown- Cherry Wine - 005 5.21
7 RSP11316-Cherry Blossom 5.35
8 RSP11271-Unknown- Cherry Wine - 004 5.51
9 RSP11303-Cherry Blossom CBG 6.29
10 RSP11320-Cherry Blossom 6.61
11 RSP11322-Cherry Blossom 6.64
12 RSP11331-Cherry Blossom 6.74
13 RSP10763-Serious Happiness 6.75
14 RSP11319-Cherry Blossom 6.76
15 RSP11307-Cherry Wine 6.87
16 RSP11305-Cherry Wine 6.9
17 RSP10941-Midnight 6.93
18 RSP11304-Cherry Blossom 7
19 RSP11361-FL30 7.05
20 RSP11243-Doug's Varin 7.06
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP10989-UP Sunrise 7.93
2 RSP11132-Cbot-2019-004 8.06
3 RSP11129-Cbot-2019-001 8.41
4 RSP10684-Blueberry Cheesecake 8.95
5 RSP11014-Durban Poison 9.2
6 RSP11000-Liberty Haze 9.3
7 RSP11097-RKM-2018-006 9.77
8 RSP11143-Cherry 9.84
9 RSP10105-QUEEN JESUS 10.2
10 RSP11033-Blue Dream 10.44
11 RSP10997-Kimbo Slice 10.47
12 RSP10667-Tygra 10.48
13 RSP11034-Italian Kiss 10.5
14 RSP10755-Recon 10.52
15 RSP11049-Hermaphrodite Research Sample1 10.63
16 RSP11100-RKM-2018-009 10.7
17 RSP10551-Sour Raspberry 10.75
18 RSP11002-CST 10.8
19 RSP11094-RKM-2018-003 10.82
20 RSP10680-Blueberry Cheesecake 10.89
MOST GENETICALLY DISTANT STRAINS FROM Cherry Blossom:
# Strain Genetic Distance
1 RSP11211-80E 14.42
2 RSP11213-80E 14.39
3 RSP11190-Red Eye OG 14.3
4 RSP11352-Star Dawg 14.04
5 RSP11341-Garlic 14.02
6 RSP11353-Rugburn OG 13.8
7 RSP10837-Skywalker OG 13.77
8 RSP11118-RKM-2018-026 13.76
9 RSP11266-Abacus 13.72
10 RSP11336-White Label 1 13.68
11 RSP11196-JL 3rd Gen Father 13.55
12 RSP11093-RKM-2018-002 13.53
13 RSP11205-Feral 13.36
14 RSP11072-SFVxTK 13.31
15 RSP11103-RKM-2018-012 13.26
16 RSP11194-JL 4th Gen 2 13.25
17 RSP11104-RKM-2018-013 13.25
18 RSP11241-501st OG 13.21
19 RSP11231-Gorilla Cookies 13.16
20 RSP10233-USO31 13.15
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR8346914 64 36

Blockchain Registration Information:

Transaction ID: ca0d7f12a1267e398972c490d5ef8b440eca1f9a85504331afe97853509b5d78
Stamping Certificate: PDF
SHASUM Hash: 14ffccb73d521d3d6fdd66d9c32c594b9d1f1036d5adb99fb5d41b7ddbbd221d