Cherry Blossom

RSP11329
StrainSEEK Cannabis Certification Report

Accession Date:

October 18, 2019

General Information

Strain: Cherry Blossom
Sample: CG7
RSP ID: RSP11329
Grower: Yabba Cannaba
Accession Date: October 18, 2019
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.58
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
GPPs1

UNIPROT

c.845_848delAAAGp.Glu282fsframeshift variantHIGHcontig676169629

IGV:Start|Jump

TGAAA/T

NGS:0.118

C90:0.000

0.118
PKSG-4a

UNIPROT

c.493G>Ap.Gly165Sermissense variantMODERATEcontig7001937904

IGV:Start|Jump

G/A

NGS:0.103

C90:0.000

0.103
PKSG-4a

UNIPROT

c.1191_1193delTTAp.Tyr398deldisruptive inframe deletionMODERATEcontig7001938600

IGV:Start|Jump

AATT/A

NGS:0.167

C90:0.000

0.167
PKSG-2a

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001944273

IGV:Start|Jump

T/C

NGS:0.101

C90:0.967

0.101
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
PKSG-4b

UNIPROT

c.352_355delACAGp.Thr118fsframeshift variantHIGHcontig7002721317

IGV:Start|Jump

CCTGT/C

NGS:0.529

C90:0.000

0.529
PKSG-4b

UNIPROT

c.324A>Cp.Glu108Aspmissense variantMODERATEcontig7002721349

IGV:Start|Jump

T/G

NGS:0.094

C90:0.000

0.094
PKSG-4b

UNIPROT

c.323A>Gp.Glu108Glymissense variantMODERATEcontig7002721350

IGV:Start|Jump

T/C

NGS:0.469

C90:0.000

0.469
DXR-2

UNIPROT

c.1319T>Cp.Ile440Thrmissense variantMODERATEcontig380285250

IGV:Start|Jump

A/G

NGS:0.480

C90:0.000

0.48
aPT4

UNIPROT

c.97T>Cp.Tyr33Hismissense variantMODERATEcontig1212828753

IGV:Start|Jump

T/C

NGS:0.439

C90:0.000

0.439
aPT4

UNIPROT

c.153A>Cp.Lys51Asnmissense variantMODERATEcontig1212828809

IGV:Start|Jump

A/C

NGS:0.375

C90:0.000

0.375
aPT4

UNIPROT

c.235_236delGTp.Val79fsframeshift variantHIGHcontig1212829030

IGV:Start|Jump

ATG/A

NGS:0.417

C90:0.000

0.417
aPT4

UNIPROT

c.238delTp.Ser80fsframeshift variantHIGHcontig1212829034

IGV:Start|Jump

AT/A

NGS:0.421

C90:0.000

0.421
aPT4

UNIPROT

c.302A>Gp.Asn101Sermissense variantMODERATEcontig1212829099

IGV:Start|Jump

A/G

NGS:0.349

C90:0.000

0.349
aPT4

UNIPROT

c.744+1_744+19delGTAATTTATTTTATTATAAsplice donor variant&splice region variant&intron variantHIGHcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/G

NGS:0.096

C90:0.000

0.096


NEAREST GENETIC RELATIVES TO Cherry Blossom:
# Relative Genetic Distance
1 RSP11306-Cherry Blossom 4.27
2 RSP11315-Cherry Blossom 4.34
3 RSP11304-Cherry Blossom 4.96
4 RSP11326-Cherry Blossom 5.21
5 RSP11322-Cherry Blossom 5.83
6 RSP11299-Cherry Blossom 5.96
7 RSP11303-Cherry Blossom CBG 6.12
8 RSP11313-Cherry Blossom 6.35
9 RSP11331-Cherry Blossom 6.37
10 RSP11325-Cherry Blossom 6.37
11 RSP11305-Cherry Wine 6.83
12 RSP11307-Cherry Wine 6.83
13 RSP11316-Cherry Blossom 6.94
14 RSP11320-Cherry Blossom 7
15 RSP11286-Queen Dream CBG 7.26
16 RSP11327-Cherry Blossom 7.32
17 RSP10684-Blueberry Cheesecake 7.36
18 RSP11324-Cherry Blossom 7.51
19 RSP11184-Domnesia 7.52
20 RSP11272-Unknown- Cherry Wine - 005 7.52
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP10684-Blueberry Cheesecake 7.95
2 RSP11132-Cbot-2019-004 9.23
3 RSP11014-Durban Poison 9.29
4 RSP11000-Liberty Haze 9.91
5 RSP11048-Gold Cracker 10.03
6 RSP10755-Recon 10.08
7 RSP11143-Cherry 10.32
8 RSP10997-Kimbo Slice 10.37
9 RSP10667-Tygra 10.4
10 RSP10991-Golden Goat 2 10.4
11 RSP11142-Cherry 10.5
12 RSP10989-UP Sunrise 10.83
13 RSP11128-Kush Hemp E1 10.87
14 RSP11002-CST 10.88
15 RSP11050-Hermaphrodite ResearchSample2 10.89
16 RSP10105-QUEEN JESUS 11.03
17 RSP11129-Cbot-2019-001 11.14
18 RSP10988-The Gift 11.17
19 RSP11123-RKM-2018-031 11.38
20 RSP11121-RKM-2018-029 11.38
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR8349191 63 38

Blockchain Registration Information:

Transaction ID: eca972e82e35e99b310333a38df27053ecbf99a92af84d022ab2271e9780cc63
Stamping Certificate: PDF
SHASUM Hash: a14c16f0eb39923833a6b2b4bfa75ac4d30de367ca959bdf8a26c233f96fdf75