Cherry Blossom

RSP11322
StrainSEEK Cannabis Certification Report

Accession Date:

October 18, 2019

General Information

Strain: Cherry Blossom
Sample: CK7
RSP ID: RSP11322
Grower: Yabba Cannaba
Accession Date: October 18, 2019
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.42
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
CBDASc.221C>Gp.Thr74Sermissense variantMODERATEcontig17722082447

IGV:Start|Jump

C/G

NGS:0.136

C90:0.057

0.136
CBDASc.1420A>Cp.Lys474Glnmissense variantMODERATEcontig17722083646

IGV:Start|Jump

A/C

NGS:0.132

C90:0.813

0.132



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
PKSG-4a

UNIPROT

c.493G>Ap.Gly165Sermissense variantMODERATEcontig7001937904

IGV:Start|Jump

G/A

NGS:0.103

C90:0.000

0.103
PKSG-4a

UNIPROT

c.1191_1193delTTAp.Tyr398deldisruptive inframe deletionMODERATEcontig7001938600

IGV:Start|Jump

AATT/A

NGS:0.167

C90:0.000

0.167
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-4b

UNIPROT

c.556A>Gp.Arg186Glymissense variant&splice region variantMODERATEcontig7002721117

IGV:Start|Jump

T/C

NGS:0.022

C90:0.000

0.022
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
PKSG-4b

UNIPROT

c.352_355delACAGp.Thr118fsframeshift variantHIGHcontig7002721317

IGV:Start|Jump

CCTGT/C

NGS:0.529

C90:0.000

0.529
PKSG-4b

UNIPROT

c.324A>Cp.Glu108Aspmissense variantMODERATEcontig7002721349

IGV:Start|Jump

T/G

NGS:0.094

C90:0.000

0.094
PKSG-4b

UNIPROT

c.323A>Gp.Glu108Glymissense variantMODERATEcontig7002721350

IGV:Start|Jump

T/C

NGS:0.469

C90:0.000

0.469
FAD2-2

UNIPROT

c.110C>Tp.Ala37Valmissense variantMODERATEcontig831803259

IGV:Start|Jump

G/A

NGS:0.013

C90:0.000

0.013
FAD2-2

UNIPROT

c.62C>Tp.Pro21Leumissense variantMODERATEcontig831803307

IGV:Start|Jump

G/A

NGS:0.042

C90:0.000

0.042
aPT4

UNIPROT

c.97T>Cp.Tyr33Hismissense variantMODERATEcontig1212828753

IGV:Start|Jump

T/C

NGS:0.439

C90:0.000

0.439
aPT4

UNIPROT

c.153A>Cp.Lys51Asnmissense variantMODERATEcontig1212828809

IGV:Start|Jump

A/C

NGS:0.375

C90:0.000

0.375
aPT4

UNIPROT

c.235_236delGTp.Val79fsframeshift variantHIGHcontig1212829030

IGV:Start|Jump

ATG/A

NGS:0.417

C90:0.000

0.417
aPT4

UNIPROT

c.238delTp.Ser80fsframeshift variantHIGHcontig1212829034

IGV:Start|Jump

AT/A

NGS:0.421

C90:0.000

0.421
aPT4

UNIPROT

c.302A>Gp.Asn101Sermissense variantMODERATEcontig1212829099

IGV:Start|Jump

A/G

NGS:0.349

C90:0.000

0.349
aPT4

UNIPROT

c.744+1_744+19delGTAATTTATTTTATTATAAsplice donor variant&splice region variant&intron variantHIGHcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/G

NGS:0.096

C90:0.000

0.096
HDS-2

UNIPROT

c.82_93delGTAACCGGAACTp.Val28_Thr31delconservative inframe deletionMODERATEcontig951989748

IGV:Start|Jump

CGTAACCGGAACT/C

NGS:0.805

C90:0.000

0.805
HDS-2

UNIPROT

c.127T>Gp.Ser43Alamissense variantMODERATEcontig951989794

IGV:Start|Jump

T/G

NGS:0.721

C90:0.000

0.721


NEAREST GENETIC RELATIVES TO Cherry Blossom:
# Relative Genetic Distance
1 RSP11306-Cherry Blossom 4.05
2 RSP11313-Cherry Blossom 4.16
3 RSP11272-Unknown- Cherry Wine - 005 4.59
4 RSP11304-Cherry Blossom 4.67
5 RSP11327-Cherry Blossom 5.31
6 RSP11330-Cherry Blossom 5.77
7 RSP11329-Cherry Blossom 5.83
8 RSP11320-Cherry Blossom 5.9
9 RSP11332-Cherry Blossom 6.32
10 RSP11301-Cherry Blossom 6.39
11 RSP11325-Cherry Blossom 6.42
12 RSP11333-Cherry Blossom 6.59
13 RSP11315-Cherry Blossom 6.64
14 RSP11303-Cherry Blossom CBG 6.85
15 RSP11326-Cherry Blossom 6.98
16 RSP11299-Cherry Blossom 7.09
17 RSP11324-Cherry Blossom 7.26
18 RSP10989-UP Sunrise 7.3
19 RSP11317-Cherry Blossom 7.36
20 RSP11010-Blue Dream 7.38
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP10989-UP Sunrise 7.44
2 RSP11129-Cbot-2019-001 8.41
3 RSP11000-Liberty Haze 9.1
4 RSP10684-Blueberry Cheesecake 9.59
5 RSP11033-Blue Dream 9.92
6 RSP11123-RKM-2018-031 10.09
7 RSP11143-Cherry 10.29
8 RSP11100-RKM-2018-009 10.3
9 RSP11034-Italian Kiss 10.31
10 RSP11014-Durban Poison 10.32
11 RSP11142-Cherry 10.45
12 RSP10997-Kimbo Slice 10.51
13 RSP10551-Sour Raspberry 10.51
14 RSP10755-Recon 10.54
15 RSP11097-RKM-2018-006 10.55
16 RSP11048-Gold Cracker 10.58
17 RSP11050-Hermaphrodite ResearchSample2 10.61
18 RSP10105-QUEEN JESUS 10.87
19 RSP11002-CST 10.99
20 RSP11049-Hermaphrodite Research Sample1 11.11
MOST GENETICALLY DISTANT STRAINS FROM Cherry Blossom:
# Strain Genetic Distance
1 RSP11093-RKM-2018-002 14.09
2 RSP11352-Star Dawg 13.95
3 RSP11030-Skunk 18 13.66
4 RSP11038-Skunk 18 13.58
5 RSP11118-RKM-2018-026 13.55
6 RSP11348-JABBA S STASH 13.5
7 RSP11232-Flo 13.33
8 RSP11196-JL 3rd Gen Father 13.26
9 RSP11176-Arcata Trainwreck 13.22
10 RSP11225-New York City Deisel 13.13
11 RSP11353-Rugburn OG 13.12
12 RSP11344-Square Wave 13.11
13 RSP11103-RKM-2018-012 13.04
14 RSP11133-Cbot-2019-005 12.99
15 RSP10233-USO31 12.99
16 RSP11193-JL 4th Gen 1 12.96
17 RSP11207-Carmaleonte 12.95
18 RSP11343-Sour D 12.95
19 RSP11205-Feral 12.91
20 RSP11231-Gorilla Cookies 12.9
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR8346625 65 39
NEAREST GENETIC RELATIVES IN LYNCH DATASET:
Nearest Lynch Strain Number of Overlapping SNPs Concordance
SRR3495321 7 6

Blockchain Registration Information:

Transaction ID: b7c164ac5e3abf624d42a79cd379cd78a8e1e0b021fd24e84c798992b1ade443
Stamping Certificate: PDF
SHASUM Hash: 64c0078182ddd2bba6e599337ebc8588e7bf2a8130154753ebb477ad8289b6e8