Cherry Blossom

RSP11324
StrainSEEK Cannabis Certification Report

Accession Date:

October 18, 2019

General Information

Strain: Cherry Blossom
Sample: CG4
RSP ID: RSP11324
Grower: Yabba Cannaba
Accession Date: October 18, 2019
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.62
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
CBDASc.221C>Gp.Thr74Sermissense variantMODERATEcontig17722082447

IGV:Start|Jump

C/G

NGS:0.136

C90:0.057

0.136
CBDASc.1420A>Cp.Lys474Glnmissense variantMODERATEcontig17722083646

IGV:Start|Jump

A/C

NGS:0.132

C90:0.813

0.132



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
PKSG-4a

UNIPROT

c.493G>Ap.Gly165Sermissense variantMODERATEcontig7001937904

IGV:Start|Jump

G/A

NGS:0.103

C90:0.000

0.103
PKSG-4a

UNIPROT

c.1191_1193delTTAp.Tyr398deldisruptive inframe deletionMODERATEcontig7001938600

IGV:Start|Jump

AATT/A

NGS:0.167

C90:0.000

0.167
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
PKSG-4b

UNIPROT

c.352_355delACAGp.Thr118fsframeshift variantHIGHcontig7002721317

IGV:Start|Jump

CCTGT/C

NGS:0.529

C90:0.000

0.529
PKSG-4b

UNIPROT

c.324A>Cp.Glu108Aspmissense variantMODERATEcontig7002721349

IGV:Start|Jump

T/G

NGS:0.094

C90:0.000

0.094
PKSG-4b

UNIPROT

c.323A>Gp.Glu108Glymissense variantMODERATEcontig7002721350

IGV:Start|Jump

T/C

NGS:0.469

C90:0.000

0.469
aPT4

UNIPROT

c.97T>Cp.Tyr33Hismissense variantMODERATEcontig1212828753

IGV:Start|Jump

T/C

NGS:0.439

C90:0.000

0.439
aPT4

UNIPROT

c.235_236delGTp.Val79fsframeshift variantHIGHcontig1212829030

IGV:Start|Jump

ATG/A

NGS:0.417

C90:0.000

0.417
aPT4

UNIPROT

c.238delTp.Ser80fsframeshift variantHIGHcontig1212829034

IGV:Start|Jump

AT/A

NGS:0.421

C90:0.000

0.421
aPT4

UNIPROT

c.302A>Gp.Asn101Sermissense variantMODERATEcontig1212829099

IGV:Start|Jump

A/G

NGS:0.349

C90:0.000

0.349
aPT4

UNIPROT

c.744+1_744+19delGTAATTTATTTTATTATAAsplice donor variant&splice region variant&intron variantHIGHcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/G

NGS:0.096

C90:0.000

0.096
aPT4

UNIPROT

c.744G>Ap.Met248Ilemissense variant&splice region variantMODERATEcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/AGTAATTTATTTTATTATAA

NGS:0.002

C90:0.000

0.002


NEAREST GENETIC RELATIVES TO Cherry Blossom:
# Relative Genetic Distance
1 RSP11333-Cherry Blossom 3.06
2 RSP11272-Unknown- Cherry Wine - 005 5.15
3 RSP11317-Cherry Blossom 5.48
4 RSP11330-Cherry Blossom 5.65
5 RSP11299-Cherry Blossom 5.73
6 RSP11331-Cherry Blossom 5.83
7 RSP11313-Cherry Blossom 5.96
8 RSP11302-Cherry Blossom 6.33
9 RSP11334-Cherry Blossom 6.64
10 RSP11332-Cherry Blossom 6.73
11 RSP11271-Unknown- Cherry Wine - 004 6.87
12 RSP11308-Cherry Blossom 7.17
13 RSP11325-Cherry Blossom 7.21
14 RSP11335-Cherry Blossom 7.21
15 RSP11322-Cherry Blossom 7.26
16 RSP11320-Cherry Blossom 7.31
17 RSP11303-Cherry Blossom CBG 7.39
18 RSP11275-Queen Dream CBG 7.42
19 RSP11329-Cherry Blossom 7.51
20 RSP11310-Cherry Blossom 7.75
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP11142-Cherry 9.32
2 RSP10755-Recon 9.4
3 RSP10684-Blueberry Cheesecake 9.41
4 RSP11014-Durban Poison 10.06
5 RSP11000-Liberty Haze 10.06
6 RSP11133-Cbot-2019-005 10.32
7 RSP10989-UP Sunrise 10.47
8 RSP11048-Gold Cracker 10.88
9 RSP10997-Kimbo Slice 10.89
10 RSP11128-Kush Hemp E1 11.03
11 RSP10988-The Gift 11.06
12 RSP11129-Cbot-2019-001 11.16
13 RSP10667-Tygra 11.22
14 RSP11050-Hermaphrodite ResearchSample2 11.26
15 RSP11097-RKM-2018-006 11.26
16 RSP11119-RKM-2018-027 11.39
17 RSP10659-Tisza 11.5
18 RSP11123-RKM-2018-031 11.56
19 RSP10658-Lovrin 11.57
20 RSP11073-Pie Hoe 11.58
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR8347299 66 39

Blockchain Registration Information:

Transaction ID: d22c7e4454ed9c70585bd5834c6ab54f16c186b098d12910bfe59d9151598615
Stamping Certificate: PDF
SHASUM Hash: a64d14f01327d4e61828eff1d707887d81ea6d2c32a6686edbcddd5d54a830a0