Carmaleonte

RSP11207
StrainSEEK Cannabis Certification Report

Accession Date:

June 27, 2019

General Information

Strain: Carmaleonte
Sample: Carmal_1_2016_CSU
RSP ID: RSP11207
Grower: John McKay-Colorado State University
Accession Date: June 27, 2019
Gender: -
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 2.19
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?


VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
PKSA-3b

UNIPROT

c.298G>Ap.Ala100Thrmissense variantMODERATEcontig7052271640

IGV:Start|Jump

C/T

NGS:0.044

C90:0.177

0.044
GPPs1

UNIPROT

c.744C>Gp.Asp248Glumissense variantMODERATEcontig676168993

IGV:Start|Jump

C/G

NGS:0.022

C90:0.000

0.022
GPPs1

UNIPROT

c.845_848delAAAGp.Glu282fsframeshift variantHIGHcontig676169629

IGV:Start|Jump

TGAAA/T

NGS:0.118

C90:0.000

0.118
GPPs1

UNIPROT

c.896A>Gp.Asn299Sermissense variantMODERATEcontig676169772

IGV:Start|Jump

A/G

NGS:0.046

C90:0.000

0.046
EMF1-2

UNIPROT

c.710A>Cp.His237Promissense variantMODERATEcontig885810

IGV:Start|Jump

A/C

NGS:0.090

C90:0.474

0.09
EMF1-2

UNIPROT

c.1187T>Cp.Leu396Sermissense variantMODERATEcontig8852073

IGV:Start|Jump

T/C

NGS:0.026

C90:0.000

0.026
EMF1-2

UNIPROT

c.2256A>Tp.Lys752Asnmissense variantMODERATEcontig8853142

IGV:Start|Jump

A/T

NGS:0.026

C90:0.000

0.026
PHL-2

UNIPROT

c.44G>Ap.Arg15Lysmissense variantMODERATEcontig2621337613

IGV:Start|Jump

G/A

NGS:0.015

C90:0.167

0.015
PHL-2

UNIPROT

c.455A>Cp.Asp152Alamissense variantMODERATEcontig2621339191

IGV:Start|Jump

A/C

NGS:0.018

C90:0.507

0.018
PHL-2

UNIPROT

c.932T>Cp.Leu311Promissense variantMODERATEcontig2621340210

IGV:Start|Jump

T/C

NGS:0.039

C90:0.268

0.039
PHL-2

UNIPROT

c.977A>Cp.His326Promissense variantMODERATEcontig2621340255

IGV:Start|Jump

A/C

NGS:0.007

C90:0.000

0.007
PHL-2

UNIPROT

c.1057A>Gp.Arg353Glymissense variantMODERATEcontig2621340335

IGV:Start|Jump

A/G

NGS:0.096

C90:0.555

0.096
PHL-2

UNIPROT

c.1096G>Ap.Ala366Thrmissense variantMODERATEcontig2621340374

IGV:Start|Jump

G/A

NGS:0.090

C90:0.531

0.09
PHL-2

UNIPROT

c.1837G>Ap.Glu613Lysmissense variantMODERATEcontig2621341115

IGV:Start|Jump

G/A

NGS:0.009

C90:0.000

0.009
PHL-2

UNIPROT

c.2564T>Ap.Phe855Tyrmissense variantMODERATEcontig2621342607

IGV:Start|Jump

T/A

NGS:0.064

C90:0.732

0.064
PHL-2

UNIPROT

c.2578T>Ap.Leu860Ilemissense variantMODERATEcontig2621342621

IGV:Start|Jump

T/A

NGS:0.068

C90:0.746

0.068
PHL-2

UNIPROT

c.2624C>Tp.Ser875Phemissense variantMODERATEcontig2621342667

IGV:Start|Jump

C/T

NGS:0.042

C90:0.268

0.042
PHL-2

UNIPROT

c.2783G>Ap.Ser928Asnmissense variantMODERATEcontig2621342826

IGV:Start|Jump

G/A

NGS:0.107

C90:0.890

0.107
PHL-2

UNIPROT

c.2830A>Cp.Asn944Hismissense variantMODERATEcontig2621342873

IGV:Start|Jump

A/C

NGS:0.044

C90:0.000

0.044
PHL-2

UNIPROT

c.2933G>Tp.Arg978Leumissense variantMODERATEcontig2621342976

IGV:Start|Jump

G/T

NGS:0.048

C90:0.297

0.048
PHL-2

UNIPROT

c.2936T>Gp.Val979Glymissense variantMODERATEcontig2621342979

IGV:Start|Jump

T/G

NGS:0.048

C90:0.000

0.048
PHL-2

UNIPROT

c.3209A>Gp.Gln1070Argmissense variantMODERATEcontig2621343252

IGV:Start|Jump

A/G

NGS:0.103

C90:0.885

0.103
PHL-2

UNIPROT

c.3467A>Gp.Gln1156Argmissense variantMODERATEcontig2621343510

IGV:Start|Jump

A/G

NGS:0.064

C90:0.713

0.064
PKSG-4a

UNIPROT

c.49_50insTGGp.Glu16_Gly17insValdisruptive inframe insertionMODERATEcontig7001936744

IGV:Start|Jump

A/AGGT

NGS:0.013

C90:0.000

0.013
PKSG-4a

UNIPROT

c.261_264dupGTACp.Met89fsframeshift variantHIGHcontig7001937671

IGV:Start|Jump

A/AGTAC

NGS:0.004

C90:0.000

0.004
PKSG-4a

UNIPROT

c.617A>Gp.Tyr206Cysmissense variantMODERATEcontig7001938028

IGV:Start|Jump

A/G

NGS:0.075

C90:0.000

0.075
PKSG-4a

UNIPROT

c.626_628delATAp.Asn209deldisruptive inframe deletionMODERATEcontig7001938032

IGV:Start|Jump

CAAT/C

NGS:0.075

C90:0.000

0.075
PKSG-4a

UNIPROT

c.1191_1193delTTAp.Tyr398deldisruptive inframe deletionMODERATEcontig7001938600

IGV:Start|Jump

AATT/A

NGS:0.167

C90:0.000

0.167
PKSG-2a

UNIPROT

c.774G>Ap.Met258Ilemissense variantMODERATEcontig7001944616

IGV:Start|Jump

C/T

NGS:0.123

C90:0.000

0.123
PKSG-2a

UNIPROT

c.67T>Ap.Phe23Ilemissense variantMODERATEcontig7001945567

IGV:Start|Jump

A/T

NGS:0.825

C90:0.904

0.825
PKSG-2b

UNIPROT

c.1132C>Gp.Leu378Valmissense variantMODERATEcontig7001950506

IGV:Start|Jump

G/C

NGS:0.717

C90:0.000

0.717
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-2b

UNIPROT

c.31A>Tp.Thr11Sermissense variantMODERATEcontig7001951851

IGV:Start|Jump

T/A

NGS:0.844

C90:0.880

0.844
PKSG-4b

UNIPROT

c.558-1G>Asplice acceptor variant&intron variantHIGHcontig7002715037

IGV:Start|Jump

C/T

NGS:0.009

C90:0.000

0.009
PKSG-4b

UNIPROT

c.535_545delATTGGAGTGGGp.Ile179fsframeshift variantHIGHcontig7002721127

IGV:Start|Jump

CCCCACTCCAAT/C

NGS:0.105

C90:0.000

0.105
PKSG-4b

UNIPROT

c.523C>Tp.His175Tyrmissense variantMODERATEcontig7002721150

IGV:Start|Jump

G/A

NGS:0.112

C90:0.325

0.112
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.353_354insCCp.Gly119fsframeshift variantHIGHcontig7002721319

IGV:Start|Jump

T/TGG

NGS:0.175

C90:0.000

0.175
PKSG-4b

UNIPROT

c.324A>Cp.Glu108Aspmissense variantMODERATEcontig7002721349

IGV:Start|Jump

T/G

NGS:0.094

C90:0.000

0.094
PKSG-4b

UNIPROT

c.323A>Gp.Glu108Glymissense variantMODERATEcontig7002721350

IGV:Start|Jump

T/C

NGS:0.469

C90:0.000

0.469
PKSG-4b

UNIPROT

c.316+2T>Asplice donor variant&intron variantHIGHcontig7002723818

IGV:Start|Jump

A/T

NGS:0.070

C90:0.689

0.07
PKSG-4b

UNIPROT

c.238T>Cp.Phe80Leumissense variantMODERATEcontig7002724197

IGV:Start|Jump

A/G

NGS:0.013

C90:0.000

0.013
DXR-2

UNIPROT

c.1319T>Gp.Ile440Sermissense variantMODERATEcontig380285250

IGV:Start|Jump

A/C

NGS:0.004

C90:0.000

0.004
DXR-2

UNIPROT

c.1319T>Cp.Ile440Thrmissense variantMODERATEcontig380285250

IGV:Start|Jump

A/G

NGS:0.480

C90:0.000

0.48
DXR-2

UNIPROT

c.431C>Gp.Ala144Glymissense variantMODERATEcontig380287760

IGV:Start|Jump

G/C

NGS:0.182

C90:0.550

0.182
OAC-2

UNIPROT

c.260C>Gp.Ser87Cysmissense variantMODERATEcontig931109979

IGV:Start|Jump

G/C

NGS:0.070

C90:0.000

0.07
OAC-2

UNIPROT

c.185C>Tp.Thr62Ilemissense variantMODERATEcontig931110054

IGV:Start|Jump

G/A

NGS:0.029

C90:0.000

0.029
OAC-2

UNIPROT

c.175G>Ap.Val59Ilemissense variantMODERATEcontig931110064

IGV:Start|Jump

C/T

NGS:0.024

C90:0.000

0.024
OAC-1

UNIPROT

c.260C>Gp.Ser87Cysmissense variantMODERATEcontig931118104

IGV:Start|Jump

G/C

NGS:0.053

C90:0.000

0.053
FAD2-2

UNIPROT

c.161T>Ap.Leu54Hismissense variantMODERATEcontig831803208

IGV:Start|Jump

A/T

NGS:0.156

C90:0.000

0.156
FAD2-2

UNIPROT

c.126C>Ap.Asp42Glumissense variantMODERATEcontig831803243

IGV:Start|Jump

G/T

NGS:0.009

C90:0.000

0.009
FAD2-2

UNIPROT

c.75C>Ap.His25Glnmissense variantMODERATEcontig831803294

IGV:Start|Jump

G/T

NGS:0.007

C90:0.000

0.007
ELF4

UNIPROT

c.144T>Ap.Asp48Glumissense variantMODERATEcontig869622426

IGV:Start|Jump

A/T

NGS:0.031

C90:0.000

0.031
ELF3

UNIPROT

c.364_366delAAGp.Lys122delconservative inframe deletionMODERATEcontig97242066

IGV:Start|Jump

AAAG/A

NGS:0.004

C90:0.000

0.004
ELF3

UNIPROT

c.757C>Tp.Pro253Sermissense variantMODERATEcontig97242463

IGV:Start|Jump

C/T

NGS:0.020

C90:0.048

0.02
ELF3

UNIPROT

c.772A>Gp.Ser258Glymissense variantMODERATEcontig97242478

IGV:Start|Jump

A/G

NGS:0.112

C90:0.000

0.112
ELF3

UNIPROT

c.812G>Cp.Gly271Alamissense variantMODERATEcontig97242518

IGV:Start|Jump

G/C

NGS:0.114

C90:0.938

0.114
ELF3

UNIPROT

c.1229+2T>Csplice donor variant&intron variantHIGHcontig97243389

IGV:Start|Jump

T/C

NGS:0.011

C90:0.000

0.011
ELF3

UNIPROT

c.1366T>Gp.Leu456Valmissense variantMODERATEcontig97244197

IGV:Start|Jump

T/G

NGS:0.015

C90:0.000

0.015
ELF3

UNIPROT

c.1435G>Cp.Ala479Promissense variantMODERATEcontig97244266

IGV:Start|Jump

G/C

NGS:0.004

C90:0.000

0.004
ELF3

UNIPROT

c.1466G>Ap.Ser489Asnmissense variantMODERATEcontig97244297

IGV:Start|Jump

G/A

NGS:0.123

C90:0.000

0.123
ELF3

UNIPROT

c.1630A>Gp.Thr544Alamissense variantMODERATEcontig97244461

IGV:Start|Jump

A/G

NGS:0.103

C90:0.545

0.103
ELF3

UNIPROT

c.1966C>Gp.Pro656Alamissense variantMODERATEcontig97244797

IGV:Start|Jump

C/G

NGS:0.123

C90:0.632

0.123
ELF3

UNIPROT

c.2140C>Tp.Pro714Sermissense variantMODERATEcontig97244971

IGV:Start|Jump

C/T

NGS:0.018

C90:0.038

0.018
ELF3

UNIPROT

c.2141C>Gp.Pro714Argmissense variantMODERATEcontig97244972

IGV:Start|Jump

C/G

NGS:0.088

C90:0.335

0.088
ELF3

UNIPROT

c.2198G>Tp.Arg733Leumissense variantMODERATEcontig97245029

IGV:Start|Jump

G/T

NGS:0.125

C90:0.531

0.125
ELF5

UNIPROT

c.520A>Gp.Thr174Alamissense variantMODERATEcontig382880382

IGV:Start|Jump

A/G

NGS:0.015

C90:0.048

0.015
aPT4

UNIPROT

c.97T>Cp.Tyr33Hismissense variantMODERATEcontig1212828753

IGV:Start|Jump

T/C

NGS:0.439

C90:0.000

0.439
aPT4

UNIPROT

c.153A>Cp.Lys51Asnmissense variantMODERATEcontig1212828809

IGV:Start|Jump

A/C

NGS:0.375

C90:0.000

0.375
aPT4

UNIPROT

c.198A>Cp.Lys66Asnmissense variantMODERATEcontig1212828854

IGV:Start|Jump

A/C

NGS:0.044

C90:0.000

0.044
aPT4

UNIPROT

c.235_236delGTp.Val79fsframeshift variantHIGHcontig1212829030

IGV:Start|Jump

ATG/A

NGS:0.417

C90:0.000

0.417
aPT4

UNIPROT

c.238delTp.Ser80fsframeshift variantHIGHcontig1212829034

IGV:Start|Jump

AT/A

NGS:0.421

C90:0.000

0.421
aPT1

UNIPROT

c.95_97delGTTp.Cys32deldisruptive inframe deletionMODERATEcontig1212835800

IGV:Start|Jump

ATGT/A

NGS:0.118

C90:0.311

0.118
aPT1

UNIPROT

c.406A>Gp.Ile136Valmissense variantMODERATEcontig1212839605

IGV:Start|Jump

A/G

NGS:0.579

C90:0.761

0.579
HDS-2

UNIPROT

c.82_93delGTAACCGGAACTp.Val28_Thr31delconservative inframe deletionMODERATEcontig951989748

IGV:Start|Jump

CGTAACCGGAACT/C

NGS:0.805

C90:0.000

0.805
HDS-2

UNIPROT

c.127T>Gp.Ser43Alamissense variantMODERATEcontig951989794

IGV:Start|Jump

T/G

NGS:0.721

C90:0.000

0.721
HDS-2

UNIPROT

c.679G>Cp.Gly227Argmissense variantMODERATEcontig951990632

IGV:Start|Jump

G/C

NGS:0.037

C90:0.000

0.037
AAE1-2

UNIPROT

c.331A>Gp.Asn111Aspmissense variantMODERATEcontig81209293

IGV:Start|Jump

A/G

NGS:0.123

C90:0.000

0.123
AAE1-2

UNIPROT

c.1006A>Gp.Lys336Glumissense variantMODERATEcontig81209968

IGV:Start|Jump

A/G

NGS:0.116

C90:0.000

0.116
AAE1-2

UNIPROT

c.1415G>Ap.Ser472Asnmissense variantMODERATEcontig81210377

IGV:Start|Jump

G/A

NGS:0.070

C90:0.000

0.07
AAE1-2

UNIPROT

c.1417A>Gp.Thr473Alamissense variantMODERATEcontig81210379

IGV:Start|Jump

A/G

NGS:0.070

C90:0.000

0.07
AAE1-2

UNIPROT

c.1434G>Tp.Glu478Aspmissense variantMODERATEcontig81210396

IGV:Start|Jump

G/T

NGS:0.075

C90:0.000

0.075
AAE1-2

UNIPROT

c.1541T>Cp.Val514Alamissense variantMODERATEcontig81210503

IGV:Start|Jump

T/C

NGS:0.050

C90:0.000

0.05
PHL-1

UNIPROT

c.2623A>Gp.Thr875Alamissense variantMODERATEcontig14391487174

IGV:Start|Jump

T/C

NGS:0.123

C90:0.000

0.123
PHL-1

UNIPROT

c.2551A>Gp.Thr851Alamissense variantMODERATEcontig14391487246

IGV:Start|Jump

T/C

NGS:0.116

C90:0.890

0.116
PHL-1

UNIPROT

c.1387A>Gp.Thr463Alamissense variantMODERATEcontig14391489811

IGV:Start|Jump

T/C

NGS:0.107

C90:0.904

0.107
PHL-1

UNIPROT

c.489A>Tp.Lys163Asnmissense variantMODERATEcontig14391490874

IGV:Start|Jump

T/A

NGS:0.002

C90:0.000

0.002
Edestin

UNIPROT

c.16T>Cp.Ser6Promissense variantMODERATEcontig8503065274

IGV:Start|Jump

A/G

NGS:0.059

C90:0.000

0.059
TFL1

UNIPROT

c.302-1G>Asplice acceptor variant&intron variantHIGHcontig1636520616

IGV:Start|Jump

C/T

NGS:0.103

C90:0.794

0.103
FAD4

UNIPROT

c.121G>Tp.Val41Phemissense variantMODERATEcontig7841690873

IGV:Start|Jump

G/T

NGS:0.044

C90:0.000

0.044
FAD4

UNIPROT

c.220C>Gp.Arg74Glymissense variantMODERATEcontig7841690972

IGV:Start|Jump

C/G

NGS:0.026

C90:0.000

0.026
HDS-1

UNIPROT

c.1618A>Gp.Ile540Valmissense variantMODERATEcontig1891885936

IGV:Start|Jump

T/C

NGS:0.099

C90:0.861

0.099
HDS-1

UNIPROT

c.136G>Ap.Val46Ilemissense variantMODERATEcontig1891889256

IGV:Start|Jump

C/T

NGS:0.088

C90:0.593

0.088
HDS-1

UNIPROT

c.56C>Gp.Ala19Glymissense variantMODERATEcontig1891889336

IGV:Start|Jump

G/C

NGS:0.125

C90:0.943

0.125
HDS-1

UNIPROT

c.35G>Ap.Cys12Tyrmissense variantMODERATEcontig1891889357

IGV:Start|Jump

C/T

NGS:0.094

C90:0.646

0.094
HDS-1

UNIPROT

c.-108+1_-108+2insGsplice donor variant&intron variantHIGHcontig1891889975

IGV:Start|Jump

A/AC

NGS:0.217

C90:0.000

0.217
PIE1-2

UNIPROT

c.6817G>Ap.Glu2273Lysmissense variantMODERATEcontig14601184270

IGV:Start|Jump

C/T

NGS:0.002

C90:0.000

0.002
PIE1-2

UNIPROT

c.6653A>Gp.Asn2218Sermissense variantMODERATEcontig14601184434

IGV:Start|Jump

T/C

NGS:0.059

C90:0.928

0.059
PIE1-2

UNIPROT

c.5932A>Gp.Ile1978Valmissense variantMODERATEcontig14601185552

IGV:Start|Jump

T/C

NGS:0.061

C90:0.268

0.061
PIE1-2

UNIPROT

c.2083_2085delGTCp.Val695delconservative inframe deletionMODERATEcontig14601189954

IGV:Start|Jump

GGAC/G

NGS:0.046

C90:0.880

0.046
PIE1-2

UNIPROT

c.2072A>Gp.His691Argmissense variantMODERATEcontig14601189968

IGV:Start|Jump

T/C

NGS:0.046

C90:0.789

0.046
PIE1-2

UNIPROT

c.1872T>Ap.Asp624Glumissense variantMODERATEcontig14601190252

IGV:Start|Jump

A/T

NGS:0.086

C90:0.990

0.086
PIE1-2

UNIPROT

c.1630G>Cp.Ala544Promissense variantMODERATEcontig14601191600

IGV:Start|Jump

C/G

NGS:0.070

C90:0.933

0.07
PIE1-2

UNIPROT

c.1289A>Gp.Asp430Glymissense variantMODERATEcontig14601192109

IGV:Start|Jump

T/C

NGS:0.079

C90:0.000

0.079
PIE1-2

UNIPROT

c.1019_1048dupATGTGGGTGAACCAACCCAGATGGAGGATAp.Asn340_Asp349dupconservative inframe insertionMODERATEcontig14601192349

IGV:Start|Jump

C/CTATCCTCCATCTGGGTTGGTTCACCCACAT

NGS:0.009

C90:0.000

0.009
PIE1-2

UNIPROT

c.982G>Ap.Glu328Lysmissense variantMODERATEcontig14601192416

IGV:Start|Jump

C/T

NGS:0.050

C90:0.976

0.05
PIE1-2

UNIPROT

c.710C>Tp.Pro237Leumissense variantMODERATEcontig14601193804

IGV:Start|Jump

G/A

NGS:0.072

C90:0.866

0.072
PIE1-2

UNIPROT

c.706T>Cp.Tyr236Hismissense variantMODERATEcontig14601193808

IGV:Start|Jump

A/G

NGS:0.059

C90:0.737

0.059
PIE1-2

UNIPROT

c.637T>Ap.Ser213Thrmissense variantMODERATEcontig14601194421

IGV:Start|Jump

A/T

NGS:0.079

C90:0.885

0.079
EMF2

UNIPROT

c.722C>Tp.Thr241Ilemissense variantMODERATEcontig9543050302

IGV:Start|Jump

C/T

NGS:0.018

C90:0.062

0.018
EMF2

UNIPROT

c.1205C>Tp.Ala402Valmissense variant&splice region variantMODERATEcontig9543055694

IGV:Start|Jump

C/T

NGS:0.015

C90:0.053

0.015
EMF2

UNIPROT

c.1228A>Gp.Ser410Glymissense variantMODERATEcontig9543055717

IGV:Start|Jump

A/G

NGS:0.015

C90:0.000

0.015
EMF2

UNIPROT

c.1315G>Cp.Ala439Promissense variantMODERATEcontig9543055804

IGV:Start|Jump

G/C

NGS:0.015

C90:0.053

0.015
EMF2

UNIPROT

c.1772A>Gp.Gln591Argmissense variantMODERATEcontig9543059929

IGV:Start|Jump

A/G

NGS:0.092

C90:0.876

0.092
EMF1-1

UNIPROT

c.242A>Gp.Lys81Argmissense variantMODERATEcontig883269731

IGV:Start|Jump

A/G

NGS:0.022

C90:0.053

0.022
FT

UNIPROT

c.29_43dupATAATAATAATAATAp.Asn10_Asn14dupdisruptive inframe insertionMODERATEcontig15613124441

IGV:Start|Jump

T/TTAATAATAATAATAA

NGS:0.026

C90:0.000

0.026
FT

UNIPROT

c.26_43dupATAATAATAATAATAATAp.Asn9_Asn14dupdisruptive inframe insertionMODERATEcontig15613124441

IGV:Start|Jump

T/TTAATAATAATAATAATAA

NGS:0.004

C90:0.000

0.004
FLD

UNIPROT

c.2981T>Cp.Met994Thrmissense variantMODERATEcontig14502044012

IGV:Start|Jump

A/G

NGS:0.064

C90:0.478

0.064
FLD

UNIPROT

c.2964C>Ap.Asp988Glumissense variantMODERATEcontig14502044029

IGV:Start|Jump

G/T

NGS:0.057

C90:0.464

0.057
FLD

UNIPROT

c.2953G>Ap.Ala985Thrmissense variantMODERATEcontig14502044040

IGV:Start|Jump

C/T

NGS:0.002

C90:0.000

0.002
FLD

UNIPROT

c.2869C>Tp.His957Tyrmissense variantMODERATEcontig14502044163

IGV:Start|Jump

G/A

NGS:0.011

C90:0.000

0.011
FLD

UNIPROT

c.2831A>Gp.Glu944Glymissense variantMODERATEcontig14502044201

IGV:Start|Jump

T/C

NGS:0.011

C90:0.000

0.011
FLD

UNIPROT

c.2686G>Ap.Ala896Thrmissense variantMODERATEcontig14502044848

IGV:Start|Jump

C/T

NGS:0.035

C90:0.225

0.035
FLD

UNIPROT

c.2681T>Cp.Ile894Thrmissense variantMODERATEcontig14502044853

IGV:Start|Jump

A/G

NGS:0.020

C90:0.144

0.02
AAE1-3

UNIPROT

c.715G>Ap.Val239Ilemissense variantMODERATEcontig9761083139

IGV:Start|Jump

C/T

NGS:0.002

C90:0.000

0.002
AAE1-3

UNIPROT

c.655C>Tp.Pro219Sermissense variantMODERATEcontig9761083199

IGV:Start|Jump

G/A

NGS:0.007

C90:0.000

0.007
AAE1-3

UNIPROT

c.635G>Ap.Gly212Aspmissense variantMODERATEcontig9761083219

IGV:Start|Jump

C/T

NGS:0.007

C90:0.000

0.007
AAE1-3

UNIPROT

c.634G>Cp.Gly212Argmissense variantMODERATEcontig9761083220

IGV:Start|Jump

C/G

NGS:0.116

C90:0.000

0.116
AAE1-3

UNIPROT

c.483_484insACTp.Thr161dupconservative inframe insertionMODERATEcontig9761083541

IGV:Start|Jump

C/CAGT

NGS:0.002

C90:0.000

0.002
AAE1-3

UNIPROT

c.480_481insCACGTAAAAATCCTCCTCTTAATTTCTTACAGCTCTTTAATCTTTTACTATTTTATTGGTTGCTGAAAACCTCGGTCAp.Asn160_Thr161insHisValLysIleLeuLeuLeuIleSerTyrSerSerLeuIlePheTyrTyrPheIleGlyCysTerLysProArgSerstop gained&conservative inframe insertionHIGHcontig9761083544

IGV:Start|Jump

T/TTGACCGAGGTTTTCAGCAACCAATAAAATAGTAAAAGATTAAAGAGCTGTAAGAAATTAAGAGGAGGATTTTTACGTG

NGS:0.002

C90:0.000

0.002
AAE1-3

UNIPROT

c.425T>Cp.Leu142Promissense variantMODERATEcontig9761083600

IGV:Start|Jump

A/G

NGS:0.002

C90:0.000

0.002
AAE1-3

UNIPROT

c.416T>Cp.Leu139Promissense variantMODERATEcontig9761083609

IGV:Start|Jump

A/G

NGS:0.061

C90:0.000

0.061
AAE1-3

UNIPROT

c.403G>Tp.Asp135Tyrmissense variantMODERATEcontig9761083622

IGV:Start|Jump

C/A

NGS:0.007

C90:0.000

0.007
AAE1-3

UNIPROT

c.382T>Cp.Tyr128Hismissense variantMODERATEcontig9761083643

IGV:Start|Jump

A/G

NGS:0.072

C90:0.000

0.072
AAE1-3

UNIPROT

c.367C>Tp.Arg123Trpmissense variantMODERATEcontig9761083658

IGV:Start|Jump

G/A

NGS:0.007

C90:0.000

0.007
AAE1-