Cherry Blossom

RSP11313
StrainSEEK Cannabis Certification Report

Accession Date:

October 17, 2019

General Information

Strain: Cherry Blossom
Sample: CD2
RSP ID: RSP11313
Grower: Yabba Cannaba
Accession Date: October 17, 2019
Gender: Female
Strain Seek Version: V2


What does this visualization mean?

Chemical Information*


Cannabinoid and Terpenoid information provided by our Partner Labs.

CANNABINOIDS

THC + THCA %: N/A
CBD + CBDA %: N/A
THCV + THCVA %: N/A
CBC + CBCA %: N/A
CBG + CBGA %: N/A
CBN + CBNA %: N/A

TERPENOIDS

  • α-Bisabolol %: N/A
    Borneol %: N/A
    Camphene %: N/A
    Carene %: N/A
    Caryophyllene oxide %: N/A
    β-Carophyllene %: N/A
    Fenchol %: N/A
    Geraniol %: N/A
    α-Humulene %: N/A
    Limonene %: N/A
    Linalool %: N/A
  • Myrcene %: N/A
    α-Phellandrene %: N/A
    Terpinolene %: N/A
    α-Terpineol %: N/A
    α-Terpinene %: N/A
    γ-Terpinene %: N/A
    Total Nerolidol %: N/A
    Total Ocimene %: N/A
    α-Pinene %: N/A
    β-Pinene %: N/A

Genetic Information

View this strain on the Phylotree
Percent Heterozygosity: 1.71
Download VCF file: Here
Download FastQ Files: Read 1 Read 2
Download BAM file: BAM index
Download Annotated Variants: ANNOTATED VCF index
Plant Type: Type III

Bt/Bd ALLELE COVERAGE

What does this visualization mean?

CBCAS COVERAGE


What does this visualization mean?

Y-RATIO DISTRIBUTION


What does this visualization mean?


VARIANTS (THCAS, CBDAS, and CBCAS)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
CBDASc.221C>Gp.Thr74Sermissense variantMODERATEcontig17722082447

IGV:Start|Jump

C/G

NGS:0.136

C90:0.057

0.136
CBDASc.1420A>Cp.Lys474Glnmissense variantMODERATEcontig17722083646

IGV:Start|Jump

A/C

NGS:0.132

C90:0.813

0.132



VARIANTS (SELECT GENES OF INTEREST)

Gene HGVS.c HGVS.p Annotation Annotation Impact Contig Contig Pos Ref/Alt Var Freq
GPPs1

UNIPROT

c.845_848delAAAGp.Glu282fsframeshift variantHIGHcontig676169629

IGV:Start|Jump

TGAAA/T

NGS:0.118

C90:0.000

0.118
PKSG-4a

UNIPROT

c.493G>Ap.Gly165Sermissense variantMODERATEcontig7001937904

IGV:Start|Jump

G/A

NGS:0.103

C90:0.000

0.103
PKSG-4a

UNIPROT

c.1191_1193delTTAp.Tyr398deldisruptive inframe deletionMODERATEcontig7001938600

IGV:Start|Jump

AATT/A

NGS:0.167

C90:0.000

0.167
PKSG-2b

UNIPROT

c.1117A>Gp.Ile373Valmissense variantMODERATEcontig7001950521

IGV:Start|Jump

T/C

NGS:0.807

C90:0.981

0.807
PKSG-4b

UNIPROT

c.496A>Gp.Lys166Glumissense variantMODERATEcontig7002721177

IGV:Start|Jump

T/C

NGS:0.651

C90:0.684

0.651
PKSG-4b

UNIPROT

c.489delTp.Phe163fsframeshift variantHIGHcontig7002721183

IGV:Start|Jump

CA/C

NGS:0.792

C90:0.761

0.792
PKSG-4b

UNIPROT

c.485A>Gp.Lys162Argmissense variantMODERATEcontig7002721188

IGV:Start|Jump

T/C

NGS:0.643

C90:0.301

0.643
PKSG-4b

UNIPROT

c.352_355delACAGp.Thr118fsframeshift variantHIGHcontig7002721317

IGV:Start|Jump

CCTGT/C

NGS:0.529

C90:0.000

0.529
PKSG-4b

UNIPROT

c.324A>Cp.Glu108Aspmissense variantMODERATEcontig7002721349

IGV:Start|Jump

T/G

NGS:0.094

C90:0.000

0.094
PKSG-4b

UNIPROT

c.323A>Gp.Glu108Glymissense variantMODERATEcontig7002721350

IGV:Start|Jump

T/C

NGS:0.469

C90:0.000

0.469
DXR-2

UNIPROT

c.1319T>Cp.Ile440Thrmissense variantMODERATEcontig380285250

IGV:Start|Jump

A/G

NGS:0.480

C90:0.000

0.48
FAD2-2

UNIPROT

c.110C>Tp.Ala37Valmissense variantMODERATEcontig831803259

IGV:Start|Jump

G/A

NGS:0.013

C90:0.000

0.013
FAD2-2

UNIPROT

c.62C>Tp.Pro21Leumissense variantMODERATEcontig831803307

IGV:Start|Jump

G/A

NGS:0.042

C90:0.000

0.042
FAD2-2

UNIPROT

c.47_57delTGAATCATACTp.Leu16fsframeshift variantHIGHcontig831803311

IGV:Start|Jump

GAGTATGATTCA/G

NGS:0.018

C90:0.000

0.018
aPT4

UNIPROT

c.97T>Cp.Tyr33Hismissense variantMODERATEcontig1212828753

IGV:Start|Jump

T/C

NGS:0.439

C90:0.000

0.439
aPT4

UNIPROT

c.153A>Cp.Lys51Asnmissense variantMODERATEcontig1212828809

IGV:Start|Jump

A/C

NGS:0.375

C90:0.000

0.375
aPT4

UNIPROT

c.235_236delGTp.Val79fsframeshift variantHIGHcontig1212829030

IGV:Start|Jump

ATG/A

NGS:0.417

C90:0.000

0.417
aPT4

UNIPROT

c.238delTp.Ser80fsframeshift variantHIGHcontig1212829034

IGV:Start|Jump

AT/A

NGS:0.421

C90:0.000

0.421
aPT4

UNIPROT

c.302A>Gp.Asn101Sermissense variantMODERATEcontig1212829099

IGV:Start|Jump

A/G

NGS:0.349

C90:0.000

0.349
aPT4

UNIPROT

c.744+1_744+19delGTAATTTATTTTATTATAAsplice donor variant&splice region variant&intron variantHIGHcontig1212831022

IGV:Start|Jump

GGTAATTTATTTTATTATAA/G

NGS:0.096

C90:0.000

0.096
HDS-2

UNIPROT

c.82_93delGTAACCGGAACTp.Val28_Thr31delconservative inframe deletionMODERATEcontig951989748

IGV:Start|Jump

CGTAACCGGAACT/C

NGS:0.805

C90:0.000

0.805
HDS-2

UNIPROT

c.127T>Gp.Ser43Alamissense variantMODERATEcontig951989794

IGV:Start|Jump

T/G

NGS:0.721

C90:0.000

0.721


NEAREST GENETIC RELATIVES TO Cherry Blossom:
# Relative Genetic Distance
1 RSP11333-Cherry Blossom 3.47
2 RSP11272-Unknown- Cherry Wine - 005 3.77
3 RSP11322-Cherry Blossom 4.16
4 RSP11302-Cherry Blossom 5.09
5 RSP11320-Cherry Blossom 5.17
6 RSP11332-Cherry Blossom 5.57
7 RSP11314-Cherry Blossom 5.58
8 RSP11304-Cherry Blossom 5.69
9 RSP11326-Cherry Blossom 5.9
10 RSP11324-Cherry Blossom 5.96
11 RSP11303-Cherry Blossom CBG 6.14
12 RSP11329-Cherry Blossom 6.35
13 RSP11299-Cherry Blossom 6.51
14 RSP11327-Cherry Blossom 6.56
15 RSP11317-Cherry Blossom 6.61
16 RSP11300-Cherry Blossom 6.67
17 RSP11330-Cherry Blossom 6.74
18 RSP11331-Cherry Blossom 6.92
19 RSP11310-Cherry Blossom 7.03
20 RSP11243-Doug's Varin 7.06
NEAREST GENETIC RELATIVES TO BASE TREE:
# Relative Genetic Distance
1 RSP11142-Cherry 8.16
2 RSP10684-Blueberry Cheesecake 8.3
3 RSP11000-Liberty Haze 8.32
4 RSP10989-UP Sunrise 8.76
5 RSP10755-Recon 9.81
6 RSP11014-Durban Poison 9.83
7 RSP11048-Gold Cracker 9.92
8 RSP10667-Tygra 10
9 RSP10105-QUEEN JESUS 10.31
10 RSP11123-RKM-2018-031 10.39
11 RSP10991-Golden Goat 2 10.48
12 RSP10997-Kimbo Slice 10.51
13 RSP10659-Tisza 10.57
14 RSP11050-Hermaphrodite ResearchSample2 10.61
15 RSP11129-Cbot-2019-001 10.68
16 RSP11097-RKM-2018-006 10.69
17 RSP11134-Cbot-2019-006 10.84
18 RSP11051-KYRG-11 10.92
19 RSP11033-Blue Dream 11.07
20 RSP11119-RKM-2018-027 11.11
MOST GENETICALLY DISTANT STRAINS FROM Cherry Blossom:
# Strain Genetic Distance
1 RSP11093-RKM-2018-002 13.74
2 RSP11185-Chem 91 13.72
3 RSP11075-JL yellow 13.51
4 RSP11214-JL 3rd Gen Mother 13.48
5 RSP11336-White Label 1 13.34
6 RSP11197-JL 3rd Gen Mother 13.16
7 RSP11352-Star Dawg 13.16
8 RSP11353-Rugburn OG 12.86
9 RSP11103-RKM-2018-012 12.74
10 RSP11118-RKM-2018-026 12.69
11 RSP11341-Garlic 12.69
12 RSP11070-Danny Noonan 12.69
13 RSP11116-RKM-2018-024 12.68
14 RSP11110-RKM-2018-018 12.63
15 RSP11343-Sour D 12.58
16 RSP11241-501st OG 12.53
17 RSP10551-Sour Raspberry 12.46
18 RSP10891-Feral 12.46
19 RSP11128-Kush Hemp E1 12.46
20 RSP11194-JL 4th Gen 2 12.45
NEAREST GENETIC RELATIVES IN PHYLOS DATASET:
Phylos Strain Number of Overlapping SNPs Concordance
SRR4448181 64 39

Blockchain Registration Information:

Transaction ID: 2a0ae17711d2f1efab27d47cb6c15ed3b07ce696787a0655206b97ad2073ca08
Stamping Certificate: PDF
SHASUM Hash: eac0adc3d9c4201b5f4a1b2839e23c6acb7803d49ec086b19b65a11fb073fdcd